Маълумот

Тавзеҳи нишонаи усул дар усули парвариши хамиртуруш

Тавзеҳи нишонаи усул дар усули парвариши хамиртуруш


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ман коғазро дар бораи фарҳанги хамиртуруш ва усулҳо мехонам, дар он гуфта мешавад:

Баъд $5$ мл стерилӣ $ M / 15 KH_2PO_4 $, ба нишеб илова карда шуд,

Чи маъно дорад $М/15$?


Penicillium: Тавсиф, сохтор ва такрористеҳсолкунӣ

Penicillium як занбӯруғи сапрофитӣ буда, бо номи қолаби кабуд ё сабз маълум аст. Мувофиқи маълумоти Raper and Thom (1949), насл 136 намудро дар бар мегирад, ки дар саросари ҷаҳон паҳн шудааст. Онҳо дар хок, дар ҳаво, дар меваҳо, сабзавот, гӯшт ва ғайра мавҷуданд.

Доруи "ҳайратангез" пенициллин бори аввал аз ҷониби ҷаноби Александр Флеминг дар беморхонаи Сант Мэри, Лондон, дар соли 1929 ҳангоми кор бо бактерияи Staphylococcus aureus, ки барои ҷӯш, карбункул, сепсис дар захмҳо ва сӯхтаҳо ва ғайра масъул аст, кашф карда шуд. бо қаламча (Penicillium notatum), ки пас аз афзоиши дуруст боиси марги 5. aureus мегардад, ки минтақаи литикиро дар атрофи худ нишон медиҳад.

Вай ин пайвастагиро ҷудо кард ва онро пенициллин номид. Дертар Рэпер ва Александр (1945) дар истеҳсоли пенициллин як штамми P. crysogenum, ки аз P. notatum самараноктар аст, интихоб карданд. Аҳамияти Penicillium дар ҷадвали 4.6 зикр шудааст.

Сохтори вегетативии Penicillium:

Ҷисми растанӣ миселӣ аст (расми 4.42А, В). Мицелия бо гифаҳои септатӣ бисёр шохадор аст, ки аз ҳуҷайраҳои тунук девордор иборат аст, ки дорои як то бисёр ядроҳо мебошанд (расми 4.42С). Ҳар як септум як сӯрохи марказӣ дорад, ки тавассути он муттасилии сито-шиплазма нигоҳ дошта мешавад.

Баъзе мицелияҳо дар зеризаминӣ амиқтар мерӯянд, то маводи ғизоиро аз худ кунанд ва дигарон дар субстрат боқӣ мемонанд ва ҳисси мицелиалӣ мерӯянд. Ғизои захиравӣ дар шакли глобулаҳои нафт мавҷуд аст.

Нашри дубора дар Penicillium:

Penicillium бо роҳҳои вегетативӣ, асексуалӣ ва ҷинсӣ афзоиш меёбад.

1. Нашри растанӣ:

Он дар натиҷаи тасодуфан шикастани мицелии растанӣ ба ду ё зиёда пораҳо ба амал меояд. Пас аз он ҳар як порча ба мисли мицелии модарӣ алоҳида мерӯяд.

2. Нашри асексуалӣ:

Таҷдиди асексуалӣ тавассути спораҳои якҳуҷайра, якядрадор, ғайриҳаракат, конидияҳое, ки дар конидиофор ташкил мешаванд, сурат мегирад (расми 4.43).

Конидиофор ҳамчун шохаи рост аз ҳама ҳуҷайраҳои мицелии вегетативӣ инкишоф меёбад. Конидиофор метавонад шоха надошта бошад (P. spinulosum, P. thomii) ё гуногун шохадор (P. expansum). Шохаи конидиофор (расми 4.44В) бо номи ramus (рами ҷамъ) маълум аст, ки минбаъд шохадор мешавад, ки бо номи metulae маълум аст. Дар нӯги ҳар як метула як миқдор фиалид ё стеригматҳои колбашакл ба вуҷуд меоянд.

Ҳар як стеригмата дар нӯги худ як қатор конидияҳоеро ба вуҷуд меорад (ҷавонаш дар назди модар ва калонтар аз он дуртар). Дар намудхо (P. spinulosum), ки кони&шидиофори бешоха доранд, стеригмата дар нуги конидиофор инкишоф меёбад. Кам (P. claviforme) бисёр конидиофорҳо ҷамъ шуда, фруктизатсияи клубшаклро ба вуҷуд меоранд, ки коремий ном дорад, ки конидияҳоро бо номи коремиоспораҳо инкишоф медиҳанд.

Дар ваќти инкишофи конидиум нўги стеригма варам мекунад ва ядрои он ба таври митозї ба ду ядро ​​људо мешавад, ки яке аз онњо ба нуги варамшуда муњољират мекунад ва бо девори људокунї минтаќаи варамшуда аз модар људо шуда, конидиуми ягонаро ташкил медињад.

Нӯги стеригма боз варам мекунад ва бо ҳамин тартиб конидиуми дуюм ба вуҷуд меояд, ки аввалинашро ба тарафи берун тела медиҳад. Ин раванд чанд маротиба такрор мешавад ва ба ин васила занҷири конидия ба вуҷуд меояд.

Конидияҳо (расми 4.44С) байзашакл, эллиптикӣ ё курашакл буда, сатҳи берунии ҳамвор, ноҳамвор, эхинулятсия ва рангҳои гуногун ба монанди сабз, зард, кабуд ва ғайра доранд.

Пас аз камолот, конидияҳо аз модар ҷудо мешаванд ва бо шамол пароканда мешаванд. Дар зеризаминии мувофиқ онҳо бо роҳи инкишоф додани найчаи гермӣ месабзанд (расми 4.44D). Ядро ба тақсимоти такрории митозӣ дучор мешавад ва ҳама ядроҳо ба найчаи герма дохил мешаванд. Ташаккули септаҳо бо дарозшавии найчаи герм идома меёбад ва дар ниҳоят мицелии нави септати шохадор ба вуҷуд меояд.

3. Нашри ҷинсӣ:

Нашри ҷинси танҳо дар чанд намуд омӯхта шудааст (расми 4.44). Он аз изогамия (P. bacillosporum), оогамия (P. vermiculatum) то соматогамия (P. brefeldianum) тафовути калонро нишон медиҳад. Аксари намудҳо гомоталлӣ мебошанд, ба истиснои якчанд намуди P. luteum гетероталлӣ мебошанд. Аскокарпҳо хеле кам ба вуҷуд меоянд. Дар асоси аскокарпҳо, наслҳои гуногунро метавон ҳамчун Europenicillium, Talaromyces ва Carpenteles таъин кард.

Насли Talaromyces аз 15 намуд иборат аст. Хамаи намудхои таларо ва шимицехои тадкикшуда гомоталлик мебошанд. Ҳисоботи такрористеҳсоли ҷинсӣ бо Talaromyces vermiculatus (= Penicillium vermiculatum) аз ҷониби Dangeard (1907) тавсиф шудааст. Ин суръат намуди оогамии таҷдиди ҷинсиро нишон медиҳад. Узви ҷинсии зан ва мард мутаносибан ascogonium ва antheridium мебошанд.

Аскогония аз ҳар як ҳуҷайраи риштаи растанӣ ҳамчун ҷисми рости якҳуҷайра ва якҳуҷайра инкишоф меёбад (расми 4.44Е). Пас аз он ядро ​​ба тақсимоти такрории митозӣ дучор шуда, 32 ё 64 ядро ​​тавлид мекунад (расми 4.44F).

Антеридиум ҳамзамон бо аскогония аз ҳама гифаҳои ҳамсоя инкишоф меёбад (расми 4.44F). Он инчунин як шохаи якҳуҷайра ва якҳуҷайра мебошад, ки дар атрофи аскогония печонида мешавад. Минтақаи апикалии шохаи антеридиалӣ бо септум бурида шуда, як антеридиуми кутоҳ, то андозае варамкардаи якҳуҷайравӣ ва якҳуҷайрадорро ташкил медиҳад (расми 4.44Г).

Пас аз пухта расидани ҳам аскогония ва ҳам антеридиум нӯги антеридий хам шуда, ба девори аскогония мерасад. Девори умумӣ дар нуқтаи тамос пароканда мешавад ва пас аз он ду ситоплазма бо ҳам омехта мешаванд.

Ядрои .antheridium (расми 4.44Н) ба аскогония (Dangeard, 1907) муњољират намекунад. Баъдтар, ҷуфтшавии ядроҳо ба аскогония танҳо тавассути ядроҳои аскогониалӣ сурат мегирад. Пас аз он, аскогония бо девори тақсимкунӣ ба ҳуҷайраҳои сершумори бинокулӣ ва шятӣ тақсим карда, яксара ҷойгир карда мешавад (расми 4.44Н).

Баъзе ҳуҷайраҳои бинуклеатҳои аского ва шиниум бо ташаккули гифаҳои бисёрҳуҷайравӣ ва ашкогении шохадор берун мешаванд, ки ҳуҷайраҳои онҳо низ дикариот мебошанд (расми 4.441). Ҳуҷайраҳои апикалии мицелияи дикариотӣ варам карда, ҳамчун ҳуҷайраҳои модарии аскус амал мекунанд (расми 4.44J).

Ҳарду ядрои ҳуҷайраи модарии аскус аз кариогамия гузашта, ядрои диплоид (2n)-ро ташкил медиҳанд (расми 4.44К). Ядро баъд аз аввал мейоз, баъд мито&шисис мегузарад ва дар натича 8 ядрои пас аз чамъ шудани баъзе ситоплазма 8 аскоспора ба вучуд меояд (расми 4.44Л).

Бо инкишофи аскогония ва антеридиум бисёр гифаҳои безарар тадриҷан бо онҳо печида мешаванд ва дар ниҳоят пас аз шакл&штании аскоспораҳо сохтори умумӣ ба бадани меваи мудаввар, яъне клейстотсий мубаддал мешавад (расми 4.44М). Аскҳо дар дохили клейстотсий номунтазам ҷойгир мешаванд. Аскоспораҳо метавонанд шакли курашакл, эллиптикӣ ё линзашакл дошта, ҳамвор, эхунуклеат, чуқурӣ (расми 4.44Н) ё девори берунии шохадор ба мисли чархи чархи паҳлӯӣ бошанд.

Аскоспораҳо бо вайроншавии девори аскус ва клейстотсий хориҷ мешаванд. Аскоспора дар зери замини мувофиқ бо ташаккули найчаи ҳомила (расми 4.440) ва дар ниҳоят ба мицелий монанд ба модар месабзад.


Нишони нуқта барои дастрасии моликият дар Objective-C аст фиристодани паём, ҳамчун қайди қавс. Яъне бо назардошти ин:

Ду сатри охирин маҳз ҳаминро тартиб медиҳанд. Ягона чизе, ки инро тағир медиҳад, ин аст, ки агар моликият дорои атрибути қабулкунанда ва/ё танзимкунанда бошад, аммо танҳо он аст, ки кадом паём фиристода мешавад, на фиристодани паём:

Ҳардуи ду сатри охир якхела тартиб дода мешаванд.

Мақоларо аз Какао дӯстдухтари ман бубинед. Моҳияти он дар он аст, ки ҳеҷ гуна ҷазо барои истифодаи яке аз дигаре вуҷуд надорад.

Аммо, нишона дидани он ки бо тағирёбандаҳои шумо чӣ рӯй дода истодааст ва тағирёбандаҳои шумо чист, душвортар мегардонад.

Ягона вақте, ки шумо фарқияти иҷроишро хоҳед дид, агар шумо амволро ҳамчун "ғайриатомӣ" қайд накунед. Сипас @synthesize ба таври худкор рамзи ҳамоҳангсозиро дар атрофи танзимоти моликияти шумо илова мекунад ва онро бехатар нигоҳ медорад - аммо танзим ва дастрасӣ сусттар аст.

Ҳамин тариқ, шумо эҳтимолан мехоҳед амволеро муайян кунед, ба монанди:

@property (ғайриатомӣ, нигоҳ доштан) NSString *myProp

Шахсан ман аломати нуқтаҳоро аз нуқтаи назари шумо муфид меҳисобам, ки шумо набояд дар бораи навиштани усулҳои дурусти танзимкунанда фикр кунед, ки ин ҳатто барои танзимкунандагони ғайриатомӣ комилан ночиз нест, зеро шумо инчунин бояд дар хотир доред, ки арзиши кӯҳнаро дуруст озод кунед. Истифодаи рамзи шаблон кӯмак мекунад, аммо шумо ҳамеша метавонед хато кунед ва ин рамзи такроршавандаест, ки дарсҳоро печидатар мекунад.

Намунае, ки бояд аз он огоҳ бошад: агар шумо танзимкунандаро худатон муайян кунед (ба ҷои он ки @synthesize эҷод кунед) ва ба пайдоиши дигар таъсири манфии муқаррар кардани арзиш шурӯъ кунед, шумо эҳтимол бояд танзимкунандаро ба ҷои занг задан бо истифода аз аломати хосият усули муқаррарӣ созед.

Истифодаи хосиятҳои семантикӣ ба назар мерасад, ки дастрасии мустақим ба арзиши воқеии зангзананда ва ҳама чизе, ки аз он фарқ мекунад, бояд тавассути ирсоли паём анҷом дода шавад, на дастрасӣ ба моликият (ҳарчанд онҳо воқеан ҳам паём мефиристанд).


3. Шустушӯи оҳании кӯҳна

Дар асри 19 ва 20 баъзе заводҳои спиртӣ алтернативаҳоро ҷустуҷӯ карданд. Онҳо мехостанд, ки маводеро истифода баранд, ки тоза кардан осонтаранд ва мӯҳлати корашон дарозтар аст. Оҳани рехтагарӣ ҷавоби ин асрҳо буд ва дар чанд корхонаи спиртӣ шумо ҳоло ҳам баъзе аз ин шустани вазнинро мебинед.

Мошинҳои рехтагарӣ дар Alt a Bhaine


Патентҳо

Маълумоти ибтидоӣ ва меъёрҳои ҷустуҷӯ

Патент ҳуҷҷати ҳуқуқӣ мебошад, ки маълумоти техникиро тавсиф мекунад. Ин барраси ба "оилаҳои патентӣ" асос ёфтааст, ки мушаххасоти тавсифи як ихтирооти асосиро муттаҳид мекунанд. Бар хилофи баррасиҳои дигар дар ин мавзӯъ (Gélinas 2009 2010a 2010b), ин патентҳои алоқаманд мувофиқи санаи пешниҳодшуда пешниҳод карда мешаванд, на санаи нашр. Ин барои муайян кардани афзалияти ихтироъҳои марбута, пайгирӣ кардани ихтироъкорони аслӣ ва беҳтар кардани тамоюлҳои технология ва ҳавасмандии ихтироъкорон мувофиқи вақт кӯмак кард. Ҳангоми таҳияи ин барраси, маълум шуд, ки дар кишварҳое мисли Олмон ва Австрия байни санаи пешниҳоди ҳуҷҷатҳо ва санаи нашр, баъзан бештар аз 5 сол, бахусус дар давраи Ҷанги Якуми Ҷаҳонӣ ва Дуюми Ҷаҳонӣ, аз соли 1914 то соли 1918, таъхирҳои зиёд ба назар мерасанд. 1939—1945.

Дар якчанд идорањои патентї афзалияти ихтироъњое, ки дар мушаххасоти баъди соли 1900 ошкор карда шудаанд, пеш аз ќабул ва нашри патентњо умуман санљида мешуданд. Аммо, дар Британияи Кабир (ГБ) мушаххасоти патентҳои қабулнашуда то соли 1883 нашр мешуданд, аммо тавсифи пурраи як патенти қабулнашудаи GB, ки соли 1924 дода шудааст (GB 192085) ёфт шуд. Патентҳои GB бо санаи дархост пештар аз соли 1916 ҳам аз рӯи соли дархост (на соли нашр) ва ҳам аз рӯи рақами силсилавӣ муайян карда шуданд, пайдарпаии нав ва пайваста рақамгузорӣ карда шуд (Риммер ва Ван Дулкен 1992).

Ин барраси кӯшиш накардааст, ки технологияи хамиртурушро пурра шарҳ диҳад, зеро патентҳо танҳо як қисми ихтироъҳои умумиро ташкил медиҳанд. Ин дар ҷои дигар фаро гирифта шудааст (Reed and Nagodawithana 1991 Gélinas 2006). Патентҳо ҳамчун далели имтиёзнок ва саривақтии таҳаввулоти манфиатҳо ва нигарониҳо дар саноати истеҳсоли хамиртуруш, махсусан дар солҳои 1900 то 2009 дида мешуданд. Ин кор инчунин баррасии патентҳои то соли 1900 нашршударо ба анҷом мерасонад (Gélinas 2010a). Аксари патентҳо тавассути ҷустуҷӯ дар пойгоҳи додаҳо ба монанди [email protected] ва Depatis ба даст оварда шудаанд. Баъзе патентҳои фаронсавӣ тавассути INPI (Institut Natl. de la Propriété Intellectuelle, Париж) фармоиш дода шуданд. Тафсилоти бештар дар бораи методология дар Gélinas (2010a) оварда шудааст. Дар наздикии анҷоми ин барраси, дастрас шудан ба китобе, ки аз ҷониби Вагнер (1936) нашр шудааст, дастрас шуд, ки реферати мухтасари бисёр патентҳои то соли 1936 оид ба хамиртуруши нонпазӣ додашударо дар бар мегирад.


Ифодаи протеин

Ифодаи сафедаҳои рекомбинантӣ, махсусан бо истифода аз векторҳо ва ҳостҳои бактериявӣ, технологияи баркамол аст. Бо усулҳои мувофиқи cDNA ва PCR, плазмидҳои экспрессияро зуд тавлид кардан мумкин аст. Пас аз муайян кардани пайдарпайии сохторҳо, плазмидҳо ба мизбони экспрессия табдил меёбанд, колонияҳои ягона гирифта мешаванд ва ферментатсия анҷом дода мешаванд. Бо E. coli, ферментатсияи 2-литр бо истифода аз васоити мураккаб тавлид мешавад

50 то 80 г (вазни нами ҳуҷайраҳо). Фарз кардани ифодаи оддии сафеда (2% то 5% аз сафедаи умумии ҳуҷайра), дар ҳуҷайраҳо аз 100 то 300 мг протеини рекомбинантӣ мавҷуд аст. Масъала, албатта, дар он аст, ки чӣ гуна онро дар шакли фаъол ҷудо кардан мумкин аст. Протеинҳои ҳалшавандаро бо ҳосили хуб (& # x0003e50%) барқарор кардан мумкин аст ва сафедаҳои ҳалнашавандаро, ки бояд аз давраи денатуратсия ва қатшаванда гузаранд, бо ҳосили камтар (5% то 20%) барқарор кардан мумкин аст. Аз ин рӯ, бо истифода аз ферментатсияҳои миқёси хурд ва таҷҳизоти коркарди лабораторӣ, сафедаҳо (ё зердоменҳои онҳо) одатан метавонанд ба миқдори кофӣ (10 то 100 мг) барои оғози аксари тадқиқотҳо, аз ҷумла муайянкунии муфассали сохторӣ истеҳсол карда шаванд. Баъзе стратегияҳо барои ноил шудан ба ифодаи сатҳи баланди генҳо дар E. coli аз ҷониби Markrides (1996) ва Baneyx (1999) баррасӣ шудаанд ва инчунин дар Шӯъбаи 5.24 муҳокима карда мешаванд.

Баъзе аз хусусиятҳои дар боло зикршуда инчунин барои истеҳсоли сафедаҳо бо истифода аз системаҳои экспрессияи эукариотикии бакуловирус ва хамиртуруш мувофиқанд, гарчанде ки барои сохтани векторҳо ва бо системаи бакуловирус ҳуҷайраҳо барои коркард тавлид кардани ҳуҷайраҳо ва таҷрибаи бештар лозим аст. Системаи ифодаи хамиртуруш метавонад интихоби оқилона барои сафедаҳо бошад, ки дар бактерияҳо таркибҳои ҳалнашаванда ва истеҳсоли сафедаҳои бо мембрана алоқамандро ташкил медиҳанд (Cereghino ва Clegg, 1999 UNITS 5.6 & # x020135.8). Системаи бакуловирус барои тавлиди сафедаҳои фосфоризатсияшуда ва гликопротеинҳо (Кост, 1999 UNITS 5.4 & # x020135.5) ва барои ифодаи якҷояи сафедаҳои мутақобила хеле муфид аст. Сохтани векторҳои устувори ифодаи сафедаи ширхӯрон вақт ва кӯшиши бештарро талаб мекунад, аммо метавонад ягона равиш барои тавлиди сафедаҳои мураккаби бисёрдоменӣ бошад (UNITS 5.9 & # x020135.10). Ҳуҷайраҳое, ки ба зичии ҳуҷайраҳои 1 𠄵 휐 9 ҳуҷайра/мл мерасанд, интизор шудан мумкин аст, ки одатан 㸐 мг/литр маҳсулот ҷудо мекунанд. Интихобан, системаҳои экспрессияи генҳои гузаранда бо истифода аз векторҳои гуногуни вирусӣ (масалан, вируси vaccinia UNITS 5.12𠄵.15) метавонанд барои тавлиди миқдори камтари сафеда истифода шаванд, ки барои таҳқиқоти техникӣ муфид аст. Ҷолиби диққат аст, ки системаҳои экспрессионии гузаранда дар ҳуҷайраҳои ширхӯрон аз ҷониби ширкатҳои биотехнологӣ фаъолона таҳия карда мешаванд (Вурм ва Бернард, 1999).

Интихоби системаи ҳост барои истеҳсоли сафедаҳои рекомбинантӣ дар қисмати 5.16 муҳокима карда мешавад ва инчунин аз ҷониби Brondyke (2009) мухтасар ҷамъбаст карда шудааст. Инчунин дар журнал оид ба истедсоли сафедадои рекомбинантй шумораи махсус чоп шудааст Пешрафтҳои биотехнология (Санчес ва Демин, 2012). Дар ин шумора шарҳҳои аълои ифода ва истеҳсоли сафедаҳо мавҷуданд E.coli (Чен, 2012) хамиртуруши (Челик ва Калик, 2012) ҳуҷайраҳои ҳашарот ва системаи бакуловирус (Drugmand et al 2012) ҳуҷайраҳои ширхӯрон (Чжу, 2012) системаҳои ҳуҷайраҳои озод (Карлсон ва дигарон, 2012) ва ҳуҷайраҳои растанӣ (Сю ва дигарон) ., 2012).

Тавре ки Чен (2012) зикр кардааст, барои бисёре аз муфаттишон интихоби ибтидоӣ аксар вақт аст Escherichia coli ки системаи бартарӣ барои таҳқиқоти лабораторӣ ва рушди ибтидоӣ дар фаъолияти тиҷоратӣ боқӣ мемонад ва барои муқоиса дар байни дигар платформаҳои гуногуни баён як меъёр аст. Ин ба чунин омилҳо ба монанди осонии коркарди генетикӣ, мавҷудияти плазмидҳои оптимизатсияшудаи экспрессия ва осонии афзоиш вобаста аст. Ин воҳид шарҳи тозакунии рекомбинати сафедаҳоро бо таваҷҷӯҳи махсус ба сафедаҳои дар E. coli. Ҷанбаҳои амалӣ ва стратегияҳо дар саросари ҷаҳон таъкид карда мешаванд ва ба қадри имкон, муҳокима ба протоколҳои намунавӣ, ки дар боқимондаи боби 6 тавсиф шудаанд, истинод карда мешавад.

Фасли аввал бо маълумоти марбут ба тозакунии сафеда, ки аз тарҷумаи пайдарпаии cDNA гирифта мешавад, дахл дорад. Пас аз он муҳокимаи мухтасари баъзе мушкилоти умумӣ, ки бо ифодаи сафедаи бактериявӣ алоқаманданд (ниг. UNIT 5.1). Банақшагирии стратегияи тозакунии сафеда талаб мекунад, ки ҳалшавандагии маҳсулоти экспрессӣ муайян карда шавад, инчунин муайян кардани ҷойгиршавии сафеда дар ҳуҷайра, масалан, цитоплазма ё периплазма муфид аст. Ин воҳид диаграммаҳои ҷараёнро дар бар мегирад, ки равишҳои муқаррар кардани ҳалшавандагӣ ва маҳаллисозии сафедаҳои аз ҷониби бактерияҳо истеҳсолшударо ҷамъбаст мекунанд (инчунин нигаред ба ВУД 5.2).

Стратегияҳои тозакунӣ барои сафедаҳои ҳалшаванда ва ҳалнашаванда дар диаграммаҳои ҷараён баррасӣ ва ҷамъбаст карда мешаванд (инчунин ба боби 1 нигаред). Бисёре аз қадамҳои инфиродии поксозӣ, махсусан онҳое, ки хроматографияро дар бар мегиранд, дар бобҳои 8 ва 9 ва дар ҷойҳои дигар ба таври муфассал фаро гирифта шудаанд (Scopes, 1994 Janson, 2011). Методология ва равишҳои дар ин ҷо тавсифшуда аслан барои амалиёти миқёси лабораторӣ мувофиқанд. Методологияҳои миқёси калон қаблан баррасӣ шуда буданд (Асенҷо ва Патрик 1990 Тэтчер, 1996 Софер ва Ҳейгел, 1997).

Бахше дар бораи гликопротеинҳое, ки дар бактерияҳо дар ҳолати ғайригликозилшуда тавлид мешаванд, барои таъкид кардан дохил карда шудааст, ки гарчанде онҳо метавонанд барои таҳқиқоти in vivo муфид набошанд, чунин сафедаҳо барои таҳқиқоти сохторӣ мувофиқанд. Қисматҳои ниҳоӣ бо коркарди сафедаҳо, миқёс ва ҳадафҳои тозакунӣ ва таҷҳизоти махсусе, ки барои тозакунӣ ва тавсифи сафедаи рекомбинантӣ заруранд, баррасӣ мешаванд.


Усули илмӣ чӣ гуна кор мекунад

Равшан аст, ки усули илмӣ воситаи пурқувват аст, аммо он маҳдудиятҳои худро дорад. Ин маҳдудиятҳо ба он асос ёфтаанд, ки гипотеза бояд санҷидашаванда ва нодуруст бошад ва таҷрибаҳо ва мушоҳидаҳо такроршаванда бошанд. Ин мавзӯъҳои муайянро аз доираи усули илмӣ берун мегузорад. Илм мавҷудияти Худо ё дигар мавҷудоти ғайритабииро исбот ё рад карда наметавонад. Баъзан, принсипҳои илмӣ барои кӯшиши додани эътимод ба ақидаҳои муайяни ғайриилмӣ истифода мешаванд, масалан тарҳи интеллектуалӣ. Тарҳрезии интеллектуалӣ ин иддао аст, ки ҷанбаҳои муайяни пайдоиши олам ва ҳаётро танҳо дар заминаи қудрати оқилона ва илоҳӣ шарҳ додан мумкин аст. Тарафдорони тарҳрезии интеллектуалӣ кӯшиш мекунанд, ки ин консепсияро ҳамчун назарияи илмӣ паҳн кунанд, то онро барои таҳиягарони барномаҳои таълимии мактабҳои давлатӣ бештар писанд гардонанд. Аммо тарҳи интеллектуалӣ илм нест, зеро мавҷудияти мавҷуди илоҳӣ бо озмоиш санҷида намешавад.

Илм инчунин қодир нест, ки баҳодиҳии арзишӣ диҳад. Он наметавонад бигӯяд, ки гармшавии глобалӣ бад аст, масалан. Он метавонад сабабҳо ва оқибатҳои гармшавии глобалиро омӯзад ва дар бораи ин натиҷаҳо гузориш диҳад, аммо наметавонад тасдиқ кунад, ки рондани мошинҳои SUV нодуруст аст ё одамоне, ки лампаҳои муқаррарии худро бо лампаҳои флуоресцентии паймон иваз накардаанд, бемасъулиятӣ мекунанд. Баъзан, ташкилотҳои муайян барои пешбурди сабабҳои худ маълумотҳои илмиро истифода мебаранд. Ин хатти байни илм ва ахлоқро норавшан мекунад ва эҷоди "илми псевдо-илм"-ро ташвиқ мекунад, ки кӯшиш мекунад маҳсулот ё идеяро бо даъвое қонунӣ кунад, ки аз санҷиши ҷиддӣ нагузаштааст.

Бо вуҷуди ин, усули илмӣ яке аз воситаҳои пурарзиштаринест, ки одамон то ҳол офаридаанд. Он ба мо кӯмак мекунад, ки мушкилоти рӯзмарраи атрофи хонаро ҳал кунем ва ҳамзамон ба мо дар фаҳмидани саволҳои амиқ дар бораи ҷаҳон ва коинот, ки мо дар он зиндагӣ мекунем, кӯмак мекунад.

Аксар вақт, ду назарияи рақобаткунанда барои тавсифи як падида вуҷуд надоранд. Аммо дар мавриди рӯшноӣ як назария кофӣ нест. Бисёре аз таҷрибаҳо ақидаро дастгирӣ мекунанд, ки рӯшноӣ мисли мавҷи тӯлонӣ рафтор мекунад. Дар маҷмӯъ, ин таҷрибаҳо назарияи мавҷи нурро ба вуҷуд оварданд. Бо вуҷуди ин, таҷрибаҳои дигар ақидаро дастгирӣ мекунанд, ки нур ҳамчун зарра рафтор мекунад. Ба ҷои партофтани як назария ва нигоҳ доштани назарияи дигар, физикҳо барои тавсифи рафтори рӯшноӣ дуализми мавҷ/зарраҳоро нигоҳ медоранд.


Таснифи микроорганизмҳо | Микробиология

Нуқтаҳои зерин се системаи асосии таснифоти микроорганизмҳоро қайд мекунанд. Системаи таснифҳо инҳоянд: 1. Системаи панҷ Салтанати таснифот 2. Ҳашт низоми салтанатии таснифот ва тасниф 3. Системаи се домении тасниф.

1. Системаи таснифоти панҷ салтанат:

Баъдтар дар асоси анатомияи ҳуҷайра организмҳои прокариотӣ ва эукариотӣ ҷудо карда шуданд ва мафҳуми бактерия ҳамчун организми прокариотӣ дар микробиология соли 1962 аз ҷониби Стамир ва Ван Ниел муқаррар карда шуд. Дар соли 1969 Уиттакер системаи панҷ салтанатро пешниҳод кард, ки аз салтанати наботот, занбӯруғҳо, ҳайвоноти ҳайвонот, протиста ва монера иборат аст (расми 2.3) барои ҳама организмҳо дар асоси системаҳои энергиябахш ва анатомияи ҳуҷайра.

Микроорганизмхои дорои хусусиятхои умумие, ки дар боло тавсиф шудаанд, дар салтанатхои монера, протиста, занбуруг ва як кисми растанихо пахн шудаанд. Дар вактхои охир муносибатхои эволюционии организмхои зинда дар асоси пайдарпаии РНК-и рибосомй ва дигар маълумотхо муайян карда шуданд.

Салтанати Monera аз prokaryoteae ҳама микроорганизмҳои прокариотро дар бар мегирад. Протиста аз организмҳои якҳуҷайра ё бисёрҳуҷайраи эукариотӣ иборат аст, аммо бофтаҳои ҳақиқӣ намерасанд. Малакути занбӯруғҳо организмҳои эукариотӣ ва бисёрядроӣ доранд.

Аъзоён режими азхудкунии ғизо доранд. Animalia ҳайвоноти бисёрҳуҷайраро дар бар мегирад, ки девори ҳуҷайра надоранд. Гирифтан усули ғизо аст. Салтанати Plantae эукариотҳои бисёрҳуҷайраро дар бар мегирад. Усули ғизои онҳо фотосинтез аст.

2. Ҳашт системаи Салтанати тасниф ва аломатгузорӣ:

Кавальер-Смит (1987, 1993) протистҳоро дар асоси ультраструктураи ҳуҷайраҳо ва созмонҳои генетикӣ (пайдабандии rRNA ва дигар маълумот) ба ҳашт салтанат ҷудо кард. Вай хамаи организмхоро ба ду империя (Бактерияхо ва Эукариотхо) таксим кард (расми 2.4). Империяи Бактерияҳо ду салтанатро дар бар мегирад (Eubacteria ва Archaeobacteria). Империяи Эукариота дорои шаш салтанат (Archezoa, Protozoa, Plantae, Chromista, Fungi ва Animalia) мебошад.

Малакути Chromista диатомҳо, алгҳои қаҳваранг, криптомонадҳо ва омицетҳоро дар бар мегирад. Аъзоёни Chromista фотосинтетикӣ мебошанд ва хромопластҳои худро дар люмени ретикулуми эндоплазмӣ доранд, аммо на дар ситоплазма.

3. Системаи се домени тасниф:

Woese (1990) қайд кард, ки бактерияҳо аз наботот ва ҳайвонот дуранд ва баръакс, наботот ва ҳайвонот аз ҳамдигар он қадар дур нестанд. Аз ин рӯ, онҳо консепсияи нави бартарии доменҳоро бар салтанат таъсис доданд ва дар соли 1991 се доменро пешниҳод карданд: Бактерияҳо, Археяҳо ва Эукария (расми 2.5).

Расми 2.5: Дарахти универсалии филогенетикӣ, ки аз пайдарпайии муқоисавии РНК рибосомаи 16S ё 18S гирифта шудааст.

Доменҳои Архей ва Эукария бо ҳам алоқаманданд. Эукария организмҳоеро дар бар мегирад, ки дорои глицерин равғании ацил-диэстери ҳамчун липидҳои мембрана ва рРНК эукариотӣ мебошанд. Домени Бактерияҳо аз чунин аъзоҳо иборат аст, ки липидҳои мембрана доранд, ба монанди диэстерҳои диацил глицерол ва рРНК эубактериалӣ.

Мем&шибери домени Archaea аз липидҳои диэстери изопреноиди глицерин (ё диглицерол тетраэтер) дар мембранаи онҳо ва рРНК-и архебактериалӣ иборат аст.

Ба маънои муосир, бактерияҳо, цианобактерияҳо, актиномицетҳо ва ғайраҳо дар домени бактерияҳо метаногенҳо организмҳои бениҳоят термофилӣ, организмҳои ниҳоят галофилӣ ва ғ. дар домени Архей ва қолабҳо, хамиртурушҳо, базидиомицетҳо, алгҳо ва протозоаҳо ва ғ. домени Эукария. Микроорганизмҳо ҳамчун маҷмӯи организмҳои эволютсионии гуногун баррасӣ мешаванд.


Онро ба ҷои бехатар интиқол диҳед

Вақте ки шиша пурра пур шуд, мо тамоми озмоиши шакар хамиртурушро ба танӯр гузаронидем. Ҳубобҳо оҳиста-оҳиста ҳаракат мекарданд ва ҳеҷ чиз барои ташвиш набуд, аммо N лаззат бурд, ки пуфакро кашад ва тамошои кафк оҳиста-оҳиста болои шиша рехт.


Мавод ва усул

Тартиби мувофиқ кардани эҳтимолияти максималӣ (Расми 2D) дар MATLAB амалӣ карда шуд ва рамзи сарчашма дар https://github.com/gerland-group/PHO5_on-off-slide_models дастрас аст.

Эҳтимолияти максималӣ мувофиқ аст

Вобаста ба марҳилаи таҳлил, мо арзишҳои параметрҳоро оптимизатсия кардем, яъне қиматҳои суръати равандҳо дар доираи модели додашуда, r → , тавассути ҳадди аксар ҷамъи арзишҳои эҳтимолии log10: LI ⁢ ( r → ) дар марҳилаи 1, LI ⁢ ( r → ) + LI ⁢ I ⁢ ( r → ) дар марҳилаи 2 ва LI ⁢ ( r → ) + LI ⁢ I ⁢ ( r → ) + LI ⁢ I ⁢ I ⁢ ( r → ) дар марҳилаи 3. ки оптималии r → метавонад дар байни марҳилаҳои гуногун фарқ кунад. Мо константаҳои иловагиро ба эҳтимолияти журнал сарфи назар кардем, то пас аз ворид кардани маҷмӯи маълумоти навбатӣ ба мувофиқат, мувофиқати комил байни модел ва маҷмӯи маълумоти иловагӣ, ки аллакай бо арзишҳои r → аз марҳилаи қаблӣ, ба ҳамон эҳтимолияти журнал оварда мерасонад. мисли пештара арзиш дорад. Дар ҳама марҳилаҳо мо функсияи fmincon MATLAB-ро барои дарёфти қиматҳои параметри r →, ки эҳтимолиятро ба ҳадди аксар мерасонанд, истифода бурдем.

Бо нишондоди параметри суръати дар расми 2 овардашуда, мо барои мисоли расми 3А дорем:

Бигзор Q ⁢ ( r → σ ) матритсаи суръати гузариши раванди Марков бошад, ки бо модели ҳолати промотор σ муайян карда шудааст, дар он ҷо r → σ вектореро ифода мекунад, ки дорои арзиши параметр(ҳо)-и танзимшавандаи ҳолати промотор σ ва ҳамаи арзишҳои параметрҳои конститутсионӣ мебошад. . Вуруди ғайридиагоналӣ Q i ⁢ j ⁢ ( r → σ ) суръати аз конфигуратсияи i ба конфигуратсияи j гузаштан аст ва танҳо барои реаксияҳои дурусти васлкунӣ, демонтажкунӣ ва лағжиш сифр нест ва сипас бо вуруди r → σ дода мешавад. ки арзиши параметри равандеро, ки ин реаксияро дар модели додашуда идора мекунад, нигоҳ медорад. Агар реаксияҳои лағжиш бо ягон раванди лағжиш дар дохили модел танзим нашаванд, суръати онҳо ба сифр муқаррар карда мешавад. Сабтҳои диагоналӣ тавассути Q i ⁢ i ⁢ ( r → σ ) = - ∑ j ≠ i Q i ⁢ j ⁢ ( r → σ ) дода мешаванд. Дар мисоли расми 3А, матритсаи суръати гузариш дар ҳолати фаъол аз тариқи (бо ' … ' ифодакунандаи вурудоти диагоналӣ) дода мешавад.

Тақсимоти устувори p i ⁢ σ аз Q ⁢ ( r → σ ) ҳалли p j ⁢ σ = ∑ i p i ⁢ σ ⁢ Q i ⁢ j ⁢ ( r → σ ) = 0 мебошад.

Пас L I ⁢ ( r → ) -ро метавон бо истифода аз тақсимоти бисёрномӣ ҳисоб кард,

бо n i ⁢ σ шумораи мушоҳидаҳои конфигуратсияҳои мувофиқи промоутерҳо мебошад (Расми 1—маълумоти сарчашмаи 1).

Барои ҳар як модел, мо 100 маҷмӯи гуногуни арзишҳои параметрҳои ибтидоиро истифода бурдем, то ҳадди ниҳоии устуворро таъмин кунем. Барои ҳисоб кардани тақсимоти устувори модели додашуда барои арзишҳои параметрҳои собит, мо алгоритми коҳиши ҳолатиро истифода бурдем (Sheskin, 1985 Grassmann et al., 1985 Shanbhag and Rao, 2003). Интихобан, теоремаи Матритса-Дарахтро барои дарёфти тақсимоти ҳолати устувори равандҳои Марков истифода бурдан мумкин аст (Вонг ва Гунавардена, 2020). Мо диапазони арзишҳои параметрро ба [10 - 2 10 2 ] маҳдуд кардем, ки яке аз арзиши суръати раванди васлшавии глобалии ҳолати фаъолшуда мебошад. Диапазони васеътари [10 - 3 10 3 ] ба натиҷаҳо таъсир нарасонд. Дар 3,6% ҳамаи моделҳо 100 кӯшиш ҳадди аққал ду арзиши гуногуни эҳтимолии максималиро пайдо карданд, ки ҳамеша хеле паст буданд. Дар 2,4% ҳамаи моделҳо, арзишҳои параметри эҳтимолии ҳадди аксар пайдошуда беназир набуданд. Дар ҳарду ҳолат, ҳеҷ яке аз ин моделҳои мушкилот дар байни моделҳои дорои эҳтимолияти максималии нисбатан баланд набуданд.

Дар марҳилаи 2, ҷамъи L I ⁢ ( r → ) ва L I ⁢ I ⁢ ( r → ) оптимизатсия карда мешавад. Фарз мекунем, ки тағироти қабати таҷрибавӣ одатан тақсим карда мешаванд, эҳтимолияти log10-и модел барои таҷдиди маълумоти нав то як доимии иловагӣ аз ҷониби

бо fs ⁢ m миёна ва fs ⁢ m var мутаносибан миёна ва дисперсионии тағирёбии қабати дастрасии ченшуда дар ҳолати фаъоли муттанти часпанда N-3 m дар макони нуклеосомаи s (ду барои N-2 ва 3 барои N-3) , fs ⁢ ( r → , κ → m ) тағирёбии қабати мувофиқи модел ва κ → m арзиши префакторҳои суръати мутанти часпанда m мебошад.

Барои ба даст овардани fs ⁢ ( r → , κ → m ) барои ҳар як модел, мо бо истифода аз қисми ғайридиагоналии матритсаи суръати гузариш Q ⁢ ( r → act ) матритсаи тағирёфтаи суръати гузаришро ҳисоб кардем ва онро аз рӯи компонент зарб кардем. бо матритсаи W ⁢ ( κ → m ) дорои арзишҳои префактор κ → m барои реаксияҳои таъсирдида барои m мутант (ва як чизи дигар). Бо истифода аз матритсаҳои тағирёфтаи суръати гузариш, мо тақсимоти ҳолати устувори мутант ва дар ниҳоят таносуби мувофиқи дастрасиро дар N-2 ва N-3 ҳисоб кардем.

Мо чор префакторро барои ҳар як мутант часпанда N-3 истифода кардем, яктогӣ барои ҳар як гурӯҳи реаксияҳо, васлкунӣ дар N-3, демонтаж дар N-3, лағжиш аз N-3 ба N-2 ва аз N-2 ба N-3 (Тасвири 2—расми замимаи 5), мутаносибан ба κ → m = (κ a ⁢ 3 м , κ d ⁢ 3 м , κ s ⁢ 23 м , κ s ⁢ 32 м ) ⊤ оварда мерасонад. Қисми берун аз диагоналии W ⁢ ( κ → m ) пас аз он дода мешавад

ки дар он диагонал аз сабаби зарб аз ҷиҳати компонент бо қисми ғайри диагоналии Q ⁢ ( r → act ) аҳамият надорад, то ки қисми ғайридиагоналии матритсаҳои гузариши мутантӣ ба даст оварда шавад. Ҳамин тариқ, L I ⁢ I танҳо ба r → амал вобаста аст. Аҳамият диҳед, ки арзишҳои дақиқи префакторҳои ҳангоми оптимизатсия пайдошуда аз ҳолати ибтидоии онҳо вобаста буданд, зеро беҳтарин арзишҳои онҳо аксар вақт ноустувор буданд ё нотакрор буданд, аммо ба ҳар ҳол ба эҳтимолияти максималӣ оварда мерасонанд.

Барои марҳилаи 3, L I ⁢ I ⁢ I ду саҳм дорам, якто барои ҳар як таҷрибаи мубодилаи гистон H3:

Ба таври қатъӣ, L I ⁢ I ⁢ I танҳо аз r → rep вобаста аст, зеро ҳама таҷрибаҳои мубодилаи гистон H3 дар ҳолати репрессия гузаронида шудаанд. Барои саҳми аввал, барои мувофиқ кардани маълумот аз Rufiange et al., 2007, мо истифода кардем

бо g миёна ва g var мутаносибан миёна ва дисперсия аз таносуби ченшудаи log2-и миқдори Парчам дар N-1 бар N-2 мебошанд (Flag-H3 MNase-ChIP дар Rufiange et al., 2007, арзишҳои таносуб 0,591 ва 0,483 барои такрори 1 ва 2 мутаносибан) ва g ⁢ ( r → , t ′ ) таносуби log2-и мувофиқи модел (ниг. фасли Маводҳо ва усулҳо: Модели мубодилаи гистон H3) барои вақти андозагирӣ t ′ = 2 соат (барои вақти таъхир).

Барои саҳми дуюм, бигзор h j маънои ченшуда таносуби муқарраршудаи log2-и Маблағи Парчамро бар маблағи Myc дар N-1 бо j = 1, 2, 3, 4 нишон медиҳад, ки чаҳор нуқтаи гуногуни вақтро нишон медиҳад. Мо h → миёна = (- 0.417, 1.24, 1.87, 2.60) ⊤ аз Dion et al., 2007 ба таври зерин ба даст овардем: мо константаҳои муқаррарии ҳар як нуқтаи вақтро бо истифода аз таносуби миёнаи ченшудаи сигнали log2 Myc/Flag, тавре ки тавсиф шудааст (иловагӣ) ҳисоб кардем. маводи Дион ва дигарон, 2007 бо истифода аз маълумоти микроаррейҳои тиҷоратии геномӣ (Agilent) бо параметрҳои ҳавзи нуклеосома, тавре ки дар фасли боло) ва сипас натиҷаҳои муқарраршудаи зондро дар мавқеи N-1 PHO5 промоутер (chr2: 431049–431108). Мутаассифона, зондҳои ҳамсоя танҳо дар минтақаҳои пайвандкунанда байни мавқеъҳои нуклеосомаҳои промоутер буданд. Тавре ки дар Дион ва дигарон, 2007 зикр гардид ва бо ҳисобҳои шахсии мо тасдиқ карда шуд, арзишҳои h j маънои номуайянии калон доранд, асосан аз сабаби доимии иловагии ноустувори нормализатсияи глобалӣ, ки ба хатогиҳои систематикӣ оварда мерасонад, дар ҳоле ки фарқияти байни нуқтаҳои вақт бо дақиқии оқилона муайян карда шудааст. Ҳамин тариқ, мо тасмим гирифтем, ки арзишҳои ченакро танҳо пас аз тағирот мувофиқ созем, ки константаҳои ноустувори глобалии нормализатсияро бо роҳи интихоби миёна дар чаҳор нуқтаи вақт ҳамчун истинод бартараф созем: h

j миёна = h j миёна - 1 / 4 ⁢ ∑ k = 1 4 h k миёна. Let C be the resulting covariance matrix after this linear transformation, assuming an independent estimated experimental standard deviation of 0.4 before the transformation. This estimate was informed by the standard deviation of the Rufiange et al., 2007 data as well as from perturbations of the nucleosome pool parameters when recalculating the normalization constants. The corresponding normalized values of the model are denoted by h

j ⁢ ( r → ) , calculated from the log2 ratios of Flag amount over Myc amount at N-1, h ⁢ ( r → , t j ) (see Materials and methods section: H3 histone exchange model), using the same transformation, with t j denoting the measurement time points. Since the four measurements at different time points were linearly mapped to always have an average of zero, the estimated density follows a degenerate multivariate normal distribution with the covariance matrix C . Thus the log10 likelihood can be calculated with

where C + is the Moore-Penrose inverse (pseudoinverse) of C .

H3 histone exchange model

To obtain the Flag and Myc amounts in a given model with given parameter values and then determine g ⁢ ( r → , t ′ ) and h ⁢ ( r → , t j ) , we used the histone pool and nucleosome turnover models in Dion et al., 2007 and assumed that the Myc H3 and Flag H3 amounts in the histone pool are given by M ( t ) = α M β M and

where we used the production rates α F = 50 / min , α M = 10 / min , the degradation rates β F = 0.01 / min , β M = 0.03 / min and the lag time t 0 = 15 min which were fitted in Dion et al., 2007. For t > t 0 , the probability that a newly assembled nucleosome contains a Flag H3 is given by

In Dion et al., 2007, the conditional probability that a given nucleosome at site л дар вакташ т contains a Flag H3 then fulfills the ordinary differential equation

with λ l being an effective turnover rate at probe position l . In our case, the dynamics of the three promoter nucleosomes are coupled, determined by the transition rate matrix Q ⁢ ( r → σ ) of a given regulated on-off-slide model. At this stage, we included different nucleosome types (i.e. Flag and Myc) into the model, replacing the eight promoter configurations by all 27 possibilities to arrange no, a Flag or a Myc nucleosome at each of the three sites. Based on Q ⁢ ( r → σ ) and P + ⁢ ( t | N ) , we define an extended Flag/Myc transition rate matrix E ⁢ ( r → σ , P + ⁢ ( t | N ) ) . Each ‘new’ assembly reaction rate in E ⁢ ( r → σ , P + ⁢ ( t | N ) ) is given by the corresponding ‘old’ assembly rate in Q ⁢ ( r → σ ) times either P + ⁢ ( t | N ) or 1 - P + ⁢ ( t | N ) , for a new Flag or Myc nucleosome, respectively. To find the corresponding ‘old’ reaction any extended Flag/Myc configuration is projected to one of the eight normal nucleosome configurations simply by ignoring the Flag/Myc tag information. For example, denoting Flag- and Myc-tagged nucleosomes with ‘F’ and ‘M’, respectively, an assembly reaction from the state (F, M, 0) to the state (F, M, M) in the extended model corresponds to an assembly reaction from state (1, 1, 0) to the state (1, 1, 1) in the normal model, and its reaction rate is multiplied by 1 - P + ⁢ ( t | N ) in the extended model, since the new nucleosome is Myc-tagged. The rates of sliding and disassembly of Flag or Myc nucleosomes are assumed to be equal to the corresponding normal sliding and disassembly rates. The probability of extended configuration i at time t is the i -th entry of q → * ⁢ ( t ) , the solution of

where σ is fixed in the repressed state, in which all histone exchange experiments took place. The log2 ratios of Flag at N-1 over Flag at N-2 amount, g ⁢ ( r → , t ) , and Flag over Myc amounts at N-1, h ⁢ ( r → , t ) , of each model then correspond to log2 ratios of sums of q i * ⁢ ( t ) over suitable configurations i with Flag or Myc nucleosomes at the wanted sites.

Sensitivity analysis

In order to determine how sloppy the found best parameter values for a given model are, we performed a simple sensitivity analysis, by calculating the log10 likelihood L I + L I ⁢ I + L I ⁢ I ⁢ I along certain directions from the best fit point in logarithmic parameter space. We found that an approximation of the real likelihood function by a second-order Taylor expansion at the best fit point worked only in a small area, as expected in a highly non-linear setting, but too small to determine parameter sloppiness properly.

As a compromise between properly scanning the parameter space and computational feasibility, we chose a small number of test directions: each fitted parameter value individually, the eigenvectors of the numerical Hessian of the likelihood function at the best fit, as well as the numerical gradient, which can be non-zero if the best fit point lies on the boundary. We ignored the boundary during the sensitivity analysis, to also take into account sloppiness that 'reaches over’ the boundary. Along these directions, we tested in exponentially increasing steps from the best fit position which positions in parameter space lead to a decrease of the likelihood by ≈ 50 % , that is, a log10 likelihood ratio change of ≈ 0.30 , which is of similar order as the log10 likelihood differences within our group of satisfactory models. We then obtained 'error bars’ for each parameter by taking the largest deviation of the log10 parameter value at the 50% likelihood level from the best value found in all tested directions (Figure 4—source data 1 and Figure 4—source data 2).

Effective chromatin opening and closing rates

The effective trajectory in time of the regulated process rate from the value of the repressed state to the value of the activated state depends on how fast the cell senses the phosphate starvation and subsequent signal processes. To obtain a reasonable upper bound for the chromatin opening rate, we assumed the regulation happens instantaneously, that is, the activated rate value of the regulated processes applies immediately at the change of the medium for a population in repressed state. Then the promoter configuration distribution decays exponentially toward the activated steady state with a rate well approximated by the negative eigenvalue of the transition rate matrix closest (but not equal) to zero, taking into account the fitted time scale. This ‘effective chromatin opening rate’ is an upper bound of how fast a given model can switch to the activated state. Conversely, we did the same calculations for the ‘effective chromatin closing rate’, which is an upper bound of how fast a given model can switch to the repressed state.

Sticky N-3 experiments

Strains 'sticky N-3 mutant 1’ and 'sticky N-3 mutant 2’ used for restriction enzyme accessibility assays were generated by transformation of linear fragments of plasmids ECS53 and ECS56, respectively, into the wild type strain BY4741 as described for the 'periodicity mutants’ in Small et al., 2014. For the sticky N-3 mutant 1, the sequence GTTTTCTCATGTAAGCGGACGTCGTC inside the PHO5 promoter was replaced with GTTTTCTTATGTAAGCTTACGTCGTC . For sticky N-3 mutant 2, GCGCAAATATGTCAACGTATTTGGAAG was replaced with GCGCAAATATGTCAAAGTATTTGGAAG . Strains were grown in YPDA medium to logarithmic phase for repressive (+Pi) and shifted from logarithmic phase to phosphate-free YNB medium (Formedia) over night for inducing (-Pi) conditions. Nuclei preparation, restriction enzyme digestion, DNA purification, secondary digest, agarose gel electrophoresis, Southern blotting, hybridization, and Phosphorimager analysis were as in Musladin et al., 2014. Secondary digest was with HaeIII for both ClaI and HhaI digests probing N-2 or N-3, respectively. The probe for both ClaI and HhaI digests corresponded to the ApaI-BamHI restriction fragment upstream of N-3.


Видеоро тамошо кунед: Абу Убайдуллох Усули Дини ахли суннат (Феврал 2023).