Маълумот

Пас аз репликатсияи ДНК дар марҳилаи S-и сикли ҳуҷайра, оё ҳама минтақаҳои геномӣ ба як сатҳи сахти таъмири ДНК дучор мешаванд?

Пас аз репликатсияи ДНК дар марҳилаи S-и сикли ҳуҷайра, оё ҳама минтақаҳои геномӣ ба як сатҳи сахти таъмири ДНК дучор мешаванд?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ба фаҳмиши (маҳдуд) ман, ду роҳи асосии мутация дар ДНК вуҷуд дорад: Муҳити зист (ултрабунафш ва ғайра) ва хатогиҳо ҳангоми тақсимоти ҳуҷайра.

Ман ҳайрон будам, ки оё механизме ҳаст, ки метавонад ба генҳои муайян афзалият диҳад, то дақиқ такрор карда шавад. Як навъ триггер, ки мегӯяд "ин гени мушаххасро дубора тафтиш кунед пеш аз идома додани такрорӣ».

Ва агар он ҷо аст Чунин механизм, пас ман ҳайронам, ки оё як навъ системаи вобастагӣ барои генҳо вуҷуд дорад, ки гурӯҳҳои генҳои дигарро назорат мекунанд. Ҳамин тавр, агар як гени муайян триггери дукаратаро "фаъол кунад", он ба таври худкор ин триггерро ба гурӯҳи генҳое, ки ба он таъсир мерасонанд, илова мекунад.

Ташаккур.


То ба ҳол, механизми маълуми таъмири ДНК ин эътироф кардани номувофиқатӣ ё нуклеотидҳои вайроншуда аз ҷониби ферментҳои атрофи ДНК аст, на бо сканкунии ДНК. Аз ин рӯ, дар чунин шароит санҷиши дубора гузаронида намешавад.


Мутацияҳои ДНК аз хатогиҳои репликатсия ё таъсири мутагенҳо ба вуҷуд меоянд. Тақсимоти ҳуҷайра метавонад ба он чизе ки бо номи G маълум аст, дохил шавад0 марҳилае, ки тақсимот боздошта мешавад. Ин ҳолат инчунин ҳамчун ҳолати ором номида мешавад (ба генҳои алоқаманд дар ин ҷо нигаред), ки аз ҳолатҳои солхӯрда фарқ мекунад, ки дар он ҳуҷайраҳои вайроншуда аз такроршавӣ, масалан, оилаи генҳои p53 пешгирӣ карда мешаванд. Протеинҳои ин генҳои охирини зикршуда барои пахш кардани тақсимоти беназорат дар ҳуҷайраҳои саратон танзим карда мешаванд, дар ҳоле ки генҳо G-ро назорат мекунанд.0 Фаза дар шароити муқаррарии физиологӣ амал мекунад, ба шарте ки ин генҳои алоқаманд худашон норасо набошанд. Канцерогенҳо як зермаҷмӯи мутагенҳо мебошанд, ки маъмулан ба генҳое, ки дар давраи ҳуҷайра иштирок мекунанд, таъсир мерасонанд.


Ман ҳайрон будам, ки оё механизме ҳаст, ки метавонад ба генҳои муайян афзалият диҳад, то дақиқ такрор шавад. Як навъ триггер, ки мегӯяд, "пеш аз идома додани такрорӣ ин гени мушаххасро ду маротиба тафтиш кунед".

Механизме, ки мегӯяд: "Ин қисмро ду маротиба тафтиш кунед, муҳим аст" ба ман ҳам маълум нест, аммо агар ман саволи шуморо дуруст фаҳмидам, ман фикр мекунам, ки ҷавоби саволи шумо дар ҷои дигар аст.

Биёед бо суръати мутатсияе, ки шумо зикр кардед, оғоз кунем, такрор кардани баъзе пайдарпайҳо тавассути полимеразаи ДНК душвортар аст (он дар он ҷо хатогиҳои бештар мекунад, масалан, дар пайдарпаии хеле такроршаванда, ситозинҳои метилонидашуда ва ғ.), бинобар ин суръати мутатсия дар ин сегментҳо баландтар аст (онҳо Нуқтаҳои гарми мутатсия номида мешаванд), аммо дар акси ҳол полимеразаи ДНК дар тамоми геном ба таври тасодуфӣ хато мекунад. Инҳо дар ҳолати беҳтар таъмир карда мешаванд. Нигоҳубини махсус дода намешавад, таъмири полимераз кӯшиш мекунад, ки ҳама чизро таъмир кунад.

Акнун, ба нуқтаи ман. Чӣ мешавад, агар таъмир ноком шавад? Дар генҳо, ки барои зинда мондани ҳуҷайраҳо, рушди организмҳо ва ғайра муҳиманд (барои он ҳаёт) шумо воқеан камтар мутатсияҳоро мебинед (агар вуҷуд дошта бошад). (ва ман боварӣ дорам, ки ин сабаби савол буд, агар хато кунам, маро ислоҳ кунед.)

Ғайр аз он, ин ҷойҳо дар геном метавонанд дар байни организмҳои гуногун хеле ҳифз карда шаванд. Бештар дар ин ҷо. Ин чӣ мегӯяд, ки табиат ба ҳуҷайраҳо / эволютсия / ҳар касе иҷозат намедиҳад озмоиш (ё хато кардан) дар ин мавқеъҳо. Агар дар ин ҷо мутация рух диҳад ва ислоҳ нашавад, ҳуҷайра танҳо мемирад ва аз ин рӯ, шумо мутатсияро дида наметавонед. Сабаби марг метавонад ҷамъшавии сафедаи заҳролуд бошад, ки ҳуҷайра бо ферментҳои вайроншуда аз он халос шуда наметавонад ё норасоии энергия, зеро он сӯзишвориро оксид карда наметавонад... оқибатҳои марговар зиёданд. Барои баъзе генҳо, ҳуҷайра метавонад маҳсулоти худро бо сафедаи дигар иваз кунад, аммо баъзеҳо муҳиманд.

(Дар организмҳои бисёрҳуҷайра метавонад онро иваз кунад, якҳуҷайра парво надорад, зеро он аллакай мурдааст)

Ман боварӣ дорам, ки ин механизмест, ки тавассути он ҳуҷайра метавонад генҳои муҳим ва "кам муҳим" -ро, ки шумо дархост кардаед, фарқ кунад.


B-Myb барои такрори дурусти ДНК дар марҳилаи бетаъхири S дар ҳуҷайраҳои ҷанинии муш муҳим аст

Хусусияти умумии ҳуҷайраҳои ҷанини барвақт аз массаи ҳуҷайраҳои дарунӣ (ICM) ва ESCs ин вобастагии мутлақ аз сикли ҳуҷайраҳои атипикӣ мебошад, ки дар он марҳилаи G1 барои нигоҳ доштани табиати худтаҷдидкунанда ва плюрипотенти онҳо кӯтоҳ карда мешавад. Омили транскрипсияи B-Myb дар паҳншавӣ, махсусан дар марҳилаҳои G2/M сикли ҳуҷайра нақш дорад. Аҷиб он аст, ки сатҳи B-Myb дар ICM/ESC дар муқоиса бо сатҳи ҳуҷайраҳои муқаррарии пролифератсия зиёда аз 100 маротиба зиёдтар аст, ки вазифаи махсусан муҳимро барои ин омили транскрипсия дар ҳуҷайраҳои бунёдии плюрипотент нишон медиҳад. B-Myb барои рушди ҷанин пас аз марҳилаи пеш аз имплантатсия муҳим аст, аммо нақши он дар ICM/ESC норавшан боқӣ мемонад. Бо истифода аз омезиши генетикаи муш, таҳлили нахи ягонаи ДНК ва тасвири баландсифати сеченака (3D), мо нишон медиҳем, ки B-Myb ба ифодаи омилҳои плюрипотенсиалӣ таъсир намерасонад, аммо ба ҷои он абляцияи B-Myb боиси қатъ шудани репликатсия мегардад. вилкаҳо ва суперфаъолшавии заводҳои такрорӣ, ки боиси номуташаккилии барномаи такрорӣ ва афзоиши танаффусҳои дукарата мегардад. Ин таъсирот қисман ба танзими транскрипсияи ғайримуқаррарии омилҳои паҳншавии давраи ҳуҷайраҳо, аз ҷумла c-Myc ва FoxM1 вобастаанд, ки пешрафти муқаррарии марҳилаи S-ро дикта мекунанд. Мо ба хулосае омадем, ки B-Myb дар марҳилаи S дар ESCҳо тавассути мусоидат ба пешрафти дурусти такрорӣ ва ба ин васила ҳуҷайраҳоро аз осеби геномӣ муҳофизат мекунад. Бозёфтҳои мо дар партави истифодаи эҳтимолии терапевтии ESC ва зарурати нигоҳ доштани тамомияти геномии онҳо аҳамияти хоса доранд.


Хулосаи муаллиф

Мутацияҳо дар SAMHD1 боиси синдроми Айкарди-Гутьер (AGS), як бемории аутоиммунии моногенӣ ба лупус мебошанд. Дар байни генҳои бо AGS алоқаманд, SAMHD1 аксар вақт дар намудҳои гуногуни варамҳо ва ашаддӣ мутатсия мешавад, ки он аз ҷиҳати биологӣ ба рушди саратон алоқаманд аст. Дар ин ҷо мо нишон медиҳем, ки SAMHD1 ҳалқаҳои R-ро, ки дар натиҷаи низоъҳои транскрипсия-репликатсия ба вуҷуд омадаанд, ҳал мекунад ва ба ин васила ба нигоҳ доштани устувории геном мусоидат мекунад. Бозёфтҳои мо дарки фаҳмиши молекулавӣ ва механикии аутоиммунӣ ва бемории саратонро таъмин мекунанд ва нишон медиҳанд, ки SAMHD1 ва R-халқаҳо биомаркерҳои потенсиалӣ ва боэътимод дар терапевтҳои зидди саратон мебошанд.

Иқтибос: Park K, Ryoo J, Joong H, Kim M, Lee S, Hwang S-Y, et al. (2021) Ген SAMHD1, ки бо синдроми Айкарди-Гутерес алоқаманд аст, якпорчагии геномро тавассути пешгирии ташаккули ҳалқаи R дар минтақаҳои ихтилофи транскрипсия ва репликатсия нигоҳ медорад. PLoS Genet 17 (4): e1009523. https://doi.org/10.1371/journal.pgen.1009523

Муҳаррир: Наталя Громак, Донишгоҳи Оксфорд, Шоҳигарии Муттаҳида

Гирифтанд: 6 октябри соли 2020 Қабул карда шуд: 29 марти соли 2021 Нашр шудааст: 15 апрели соли 2021

Ҳуқуқи муаллифӣ: © 2021 Park et al. Ин мақолаи дастраси кушод аст, ки тибқи шартҳои Литсензияи Creative Commons Attribution паҳн карда шудааст, ки ба истифодаи бидуни маҳдудият, паҳнкунӣ ва таҷдид дар ҳама гуна васоил иҷозат медиҳад, ба шарте ки муаллифи аслӣ ва манбаъ ба ҳисоб гирифта шавад.

Мавҷудияти маълумот: Маълумот дар бораи биоинформатика ва рақамҳои дар ин таҳқиқот гузоришшуда дар зери GitHub дастрасанд (https://github.com/spiritmage72/samhd1_rloop). Скриптҳои тағирёфтаи питонҳои фармоишӣ, ки барои муайян кардани сигнали DRIP-seq дар минтақаҳои HO ва CD истифода мешаванд, дар зери GitHub дастрас карда шуданд (https://github.com/spiritmage72/samhd1_rloop). Ҳама маълумоти рақамии мувофиқ барои ҳамаи графикҳо ва омори ҷамъбастӣ ё дар ҷадвалҳои иттилооти дастгирӣ ё ба маълумоти дахлдор дохил карда шудаанд.

Маблағгузорӣ: Ин кор аз ҷониби Институти илмҳои бунёдии Вазорати илм Грант (IBS-R008-D1) ва гранти Бунёди Миллии Тадқиқоти Корея, ки аз ҷониби ҳукумати Корея маблағгузорӣ карда мешавад (NRF-2020R1A5A1018081) (ба KA), (NRF-2020R1A2C3011298) ) (ба KA ва КП), ва BK21 плюс идрорпулӣ (A0423-20200100) (ба КП). Маблағгузорон дар тарҳрезии омӯзиш, ҷамъоварӣ ва таҳлили маълумот, тасмим дар бораи нашр ё омода кардани дастнавис нақш надоштанд.

Манфиатҳои рақобаткунанда: Муаллифон изҳор доштаанд, ки манфиатҳои рақобаткунанда вуҷуд надоранд.


Муҳокима

Фаҳмиши мо дар бораи функсияҳои танзимкунандагони транскрипсияи ба пайдарпай хос қисман бо дониши мо дар бораи генҳои ҳадафи онҳо маҳдуд аст. Мо як протоколи мустаҳкамро барои муайян кардани маконҳои ҳатмии геномӣ барои омилҳои пайвасткунандаи ДНК дар ҳуҷайраҳои ширхӯрон таҳия кардем, ки иммунопреципиатсияи комплексҳои ба ҳам алоқаманди протеин-ДНК-ро бо таҳлили микроаррейи ДНК-и промоутерҳо барои генҳое, ки аз ҷониби сикли ҳуҷайра танзим карда мешаванд, муттаҳид мекунад. Ин усул барои муайян кардани промоутерҳои ҳадафи E2F истифода шуд, ки мо бо истифода аз ду таҳлили мустақил тафтиш кардем. Натиҷаҳои мо нишон медиҳанд, ки E2Fs дар танзими генҳо иштирок мекунанд, ки ҷузъҳои нуқтаи гузариши осеби ДНК ва роҳҳои таъмирро рамзгузорӣ мекунанд, инчунин омилҳое, ки дар ҷамъбаст/конденсатсияи хроматин, сегрегатсияи хромосомаҳо ва нуқтаи назорати шпиндели митозӣ иштирок мекунанд.

Таҷрибаҳои қаблӣ ҳадафҳои E2F-ро тавассути профили генҳои фаъол ва репрессияшуда дар посух ба ифодаи эктопикии E2F1, E2F2 ва E2F3 муайян карданд (Ishida et al. 2001 Kalma et al. 2001 Muller et al. 2001). Бо вуҷуди ин, ду маҳдудияти эҳтимолии чунин таҷрибаҳо тавассути ин равиш ҷорӣ карда мешаванд. Аввалан, потенсиали аз даст додани хосияти ҳадаф, ки дар натиҷаи аз ҳад зиёд ифода меёбад, вуҷуд дорад. Дуввум, ин навъи таҷриба имкон намедиҳад, ки ҳадафҳои мустақим муайян карда шавад, зеро тағйироти дуюмдараҷаи ифодаи генҳо, ки дар натиҷаи пешравӣ тавассути давраи ҳуҷайра имконпазир аст (Ишида ва дигарон 2001). Баръакс, таҷрибаҳои мустақими ҳатмии дар ин ҷо тавсифшуда ҳарду мушкилотро бартараф мекунанд ва имкон медиҳанд, ки промоутерҳо, ки мустақиман тавассути E2F дар ҳуҷайраҳои ибтидоӣ дар шароити физиологӣ пайвастанд, муайян карда шаванд.

Пайвастагии фаъолкунандаи транскрипсия ба минтақаи промотори ген аз он шаҳодат медиҳад, ки фаъолкунанда ба ген таъсири танзимкунанда дорад, аммо эҳтимол дорад, ки фаъолкунанда генро пурра ё ҳатто қисман назорат намекунад. Аз ин сабаб, мо маҷмӯи генҳоро муайян кардем, ки алоқамандии омил бо ифодаи ген алоқаманд аст, равише, ки дар таҳқиқоти қаблӣ бо омилҳои дигар маълумоти хеле дақиқ дар бораи функсияи транскрипсияро ба вуҷуд овард (Рен ва дигарон 2000). Мо инчунин аҳамияти ҳатмии E2F-ро ба якчанд ҳадафҳои нав, ки дар ин ҷо муайян карда шудаанд, тавассути тафтиши ифодаи генҳо дар ҳуҷайраҳо, ки репрессорҳои p107 ва p130, ки аз ҷониби E2F4 ҷалб карда шудаанд, тасдиқ кардем. Мо дарёфтем, ки ифодаи ҳар яке аз ин ҳадафҳо дар ҳуҷайраҳои дорои p107 ва p130 ба таври назаррас танзим карда шудааст. Ин бозёфтҳо мувофиқати функсионалии ҳатмии E2F-ро дар vivo ба ҳадафҳое, ки дар таҳлили макони мо муайян шудаанд, тасдиқ мекунанд.

Таснифи ҳадафҳои E2F

Бо истифода аз микромасифи нави ДНК, ки ба мо имкон медиҳад, ки пайвастагии промоутерро барои аксарияти генҳои инсон, ки ифодаи онҳо бо сикли ҳуҷайра тағйирёбанда маълум аст, назорат кунем, мо шумораи зиёди генҳои эҳтимолии E2F-ро муайян кардем. Шумораи зиёди ин генҳои мавриди ҳадафи E2F қаблан бо функсияи E2F алоқаманд набуданд. Аз ин кор дар асоси кластеризатсияи функсионалии ҳадафҳои E2F, ки мо муайян кардаем, якчанд хулосаҳои муҳим баровардан мумкин аст.

Танзими сикли ҳуҷайра

Мо ҳашт генро муайян кардем, ки дар назорати сикли ҳуҷайра нақши хуб доранд. Ин кластер дар бар мегирадcyclin A, Cdc2, Cdc25A, CDK2, ду аъзои оилаи E2F (E2F2 ва E2F3) ва ду аъзои оилаи RB (RB ва саҳ107). Ҳар яке аз ин генҳо ҳамчун E2F ҷавобгар дониста мешуданд ва кори мо тасдиқ мекунад, ки онҳо воқеан ҳадафҳои мустақими физиологии E2F мебошанд.

Репликатсияи ДНК

Нақши E2F дар фаъолсозии якчанд генҳои репликатсияи ДНК хуб муайян шудааст. Ҳадафҳои маълуми E2F иборатанд аз генҳое мебошанд, ки сафедаҳоеро, ки дар оғози репликатсия иштирок мекунанд (Orc1, сафедаҳои Mcm, Cdc6), мубодилаи нуклеотидҳо (тимидин киназа) ва синтези ферментативии ДНК (ДНК полимераза α). Таҳқиқоти мо ин рӯйхатро барои дохил кардани синтези иловагии нуклеотидҳо ва генҳои омили репликатсия васеъ карданд. Ин натиҷаҳо бо кори Невинс ва ҳамкасбон ва дигарон мувофиқат мекунанд (Ишида ва дигарон 2001 Калма ва дигарон 2001), ки ба наздикӣ бо роҳи экспресс-профилизатсияи якчанд генҳое, ки мо ҳамчун ҳадафҳои мустақими E2F ҷудо кардаем, муайян карданд.

Нуқтаи назорати шпиндели митоз ва митоз

Корҳои қаблӣ дар даҳсолаи охир нақши асосиро барои E2F дар танзими G1Гузариши марҳилаи / S ва ҳоло маълум аст, ки сиклинҳо барои ин гузариш муҳиманд ва як гурӯҳи омилҳо ва ферментҳои такрорӣ ҳадафҳои физиологии E2F мебошанд. Бо вуҷуди ин, як идеяи пайдошуда аз таҳқиқоти охирин нишон медиҳад, ки E2F метавонад барои танзими ифодаи генҳои сиклин берун аз марҳилаи S талаб карда шавад (Лукас ва дигарон 1999) ва экспресс-профилизатсия якчанд ҳадафҳои потенсиалии поёнобро, ки дар митоз иштирок мекунанд, муайян кард (Ишида ва дигарон 2001). Бо вуҷуди ин, бо назардошти огоҳиҳои марбут ба ин навъи таҷриба, ки дар боло тавсиф шудааст, фарқ кардани мустақим аз ҳадафҳои ғайримустақим ғайриимкон буд. Мо шумораи зиёди генҳоро муайян кардем, ки дар митоз кор мекунанд. Дар байни ин рӯйхат генҳо буданд, ки дар ситокинез нақш мебозанд (Плк,ЧХР1), конденсатсияи хромосома (SMC4, SMC2) ва сегрегатсияи хромосомаҳо (секурин ё ПТТГ1,CENP-E, HEC1). Таҷрибаҳои мо ба таври қатъӣ нишон медиҳанд, ки E2F дар танзими якчанд генҳои дар митоз иштирокдошта нақши мустақим мебозад. Ҷолиб он аст, ки мо инчунин якчанд ҷузъҳои нуқтаи назорати шпиндели митозиро муайян кардем, аз ҷумла CENP-E, Bub3 ва Mad2, сафедаҳое, ки бо Bub1 мутақобила мекунанд, ки онро Невинс ва ҳамкорон ҳамчун ҳадафи E2F муайян кардаанд (Ишида ва дигарон. 2001). Ҳамин тариқ, кори мо муайян мекунад, ки E2F промоутерҳои генҳои бо рӯйдодҳои пас аз S-фаза алоқамандро мустақиман мепайвандад ва нишон медиҳад, ки он дар ифодаи онҳо нақши муҳим мебозад.

Таъмири ДНК

Ҷолиб он аст, ки мо як кластери калони 12 генро муайян кардем, ки барои таъмири ДНК заруранд. Ин генҳо дар доираи пурраи равандҳои таъмир, аз ҷумла таъмири номувофиқӣ (MSH2,MLH1), таъмири решаканкунии асос (УНГ), таъмири нуклеотидҳо (RPA3), рекомбинатсияи гомологӣ (RAD51 ва RAD54) ва пайвастшавии охири гомологӣ (киназаи протеин вобаста ба ДНК). Ин таҷрибаҳо метавонанд ба нигоҳдории падидае, ки дар аввал қайд карда шудаанд, ишора кунанд Saccharomyces cerevisiae, яъне, генҳое, ки дар таъмири осеби ДНК иштирок мекунанд, метавонанд ҳангоми такрорӣ барои таъмини якпорчагии геномӣ талаб карда шаванд (Myung et al. 2001). Бисёре аз генҳои дар ин экран ҷудошуда аъзои комплексҳои мултимерикӣ мебошанд ва маълумоти мо нишон медиҳанд, ки онҳо метавонанд ҳамоҳанг карда шаванд. Масалан, таъсири мутақобилаи FEN1-PCNA, Rad51-Rad54, Msh2-Mlh1 ва Bard1-Cstf1 гузориш дода шудааст ва дар байни дигар категорияҳои функсионалӣ низ якчанд ҷуфт сафедаҳои мутақобила пайдо шуданд. Бисёре аз ин генҳо ҳангоми ғайрифаъол будан бо E2F4 дар ҳуҷайраҳои ором ва бо фаъолкунандаи E2F1 дар G пайваст мешаванд.1/ S ҳуҷайраҳои марҳилаи вақте ки ҳар як ифода карда мешавад (расми 3). Гайр аз ин, тахлили мо намуди вахшй васаҳ107 −/− саҳ130 −/− MEFҳо нишон медиҳанд, ки ҳадди аққал ду генҳо (RAD54L ваБАРД1) дар vivo аз ҷониби ин сафедаҳои марбут ба pRB ҳангоми G0 ва аввали Г1 (Расми 5). Мувофиқи бозёфтҳои мо, мурини Rad51 дар ҳуҷайраҳои эктопикӣ E2F1 ё E2F2-ро якчанд маротиба ба вуҷуд овард (Ишида ва дигарон 2001). Аз ин рӯ, бозёфтҳои мо равандҳои репликатсия ва таъмири ДНК-ро дар ҳуҷайраҳои ширхӯрон мепайвандад ва нишон медиҳанд, ки ифодаи онҳоро тавассути омили умумӣ, E2F танзим кардан мумкин аст.

Назорати нуқтаи назоратӣ

Яке аз бозёфтҳои аҷибтарини мо ин муайян кардани як кластери генҳо буд, ки дар якчанд гузаргоҳҳои гуногун иштирок мекунанд. Мо ду генро муайян кардем, ки дар нуқтаи назорати зарари ДНК иштирок мекунанд, саҳ53 ва Чк1. саҳ53 дар посух ба осеби ДНК ба вуҷуд меояд ва барои иҷрои блоки сикли ҳуҷайра дар G амал мекунад1 марҳила (Чжоу ва Элледж 2000). Муайян кардани p53 ҳамчун ҳадафи E2F ғайричашмдошт буд, зеро саҳ53 промоутер сайти консенсуси шинохташавандаи E2F надорад (маълумот нишон дода нашудааст). Ин бозёфтро метавон бо ҷалби ғайримустақими E2F бо омилҳои иловагии марбут ба промоутер шарҳ дод. Қаблан нишон дода шуда буд, ки E2F тавассути фаъолсозии он сатҳи p53-ро бавосита афзоиш медиҳадсаҳ14 ARF ген, як ҷузъи роҳи устуворсозии p14 ARF -Mdm2 (DeGregori et al. 1997Bates et al. 1998 Robertson and Jones 1998). Натиҷаҳои мо нишон медиҳанд, ки E2F низ метавонад мустақиман назорат кунад саҳ53 сатҳи ифода. Ин бозёфт инчунин дар партави гузоришҳои қаблӣ ҷолиб аст, ки нақши муҳимро ҳам барои p53 ва ҳам оилаи pRB дар G.1 Нуқтаи боздошти зарари ДНК (Harrington et al. 1998 Dannenberg et al. 2000 Sage et al. 2000). Механизмҳое, ки дар асоси талаботи pRB барои ин Г1 блок маълум нест, гарчанде ки нақш барои генҳои E2F-ҷавобгӯ пешгӯӣ шудааст (Harrington et al. 1998). Як гени дуюми гузаргоҳ, Чк1, инчунин дар таҳлили ҷойгиршавии E2F мо муайян карда шуд. CHK1 барои G2 Зарари ДНК (ва шояд марҳилаи S) нуқтаи назорати (Чжоу ва Элледж 2000). Ҷолиб он аст, ки барои pRB лозим буд Чк1 танзим ва аз нав баркарор намудани Г2 пас аз осеби ДНК, нишон медиҳад, ки E2F метавонад дар он иштирок кунад Чк1 ифодаи ген (Gottifredi et al. 2001).

Мо инчунин якчанд ҷузъҳои нуқтаи назорати шпиндели митозиро муайян кардем, аз ҷумла CENP-E, Bub3, Mad2 ва киназаи TTK (гомологи хамиртуруши Mps1p). Ин сафедаҳо нишон дода шудаанд, ки мутақобила мекунанд ва боз нишон медиҳанд, ки ин гузаргоҳ метавонад ҳамоҳангшуда тавассути E2F назорат карда шавад. Ҷолиб он аст, ки мо дарёфтем, ки ду аз ин генҳо, MAD2L ваТТК, инчунин якчанд генҳои митозӣ (HEC,NEK2, ва ПТТГ1), дар давраи ором ва аввали Г1 ҳуҷайраҳои норасоии E2F4-p107 / p130 репрессор.

Якҷоя бо таҷрибаҳои профили экспрессионалӣ ва таҳлили мо дар бораи MEF-ҳои ваҳшӣ ва мутантӣ, кластерсозии дар боло зикршуда нишон медиҳад, ки назорати зарари ДНК ва нуқтаи назорат тавассути танзими E2F метавонад ба сикли ҳуҷайра ворид карда шавад (расми 6). Яъне, ҳар яке аз ин генҳои таъмир ва гузаргоҳ дар ҳуҷайраҳое, ки аз давраи ҳуҷайра баромадаанд ва ниёз ба таъмири фаврӣ надоранд, ғайрифаъол мебошанд. Ин ҳолати ғайрифаъол бо ҳатмии E2F4 алоқаманд аст.Чунин ба назар мерасад, ки ин идея бо таҳқиқоти охирин дар ҳуҷайраҳои муш мувофиқат мекунад, ки дар он нишон дода шудааст, ки паҳншавӣ барои таъмири мутатсияҳо лозим аст (Bielas and Heddle 2000). Бо вуҷуди ин, вақте ки ҳуҷайраҳо ба давраи ҳуҷайра дубора ворид мешаванд ва ба марҳилаи S наздик мешаванд, генҳоро фаъол кардан лозим аст, ки барои таъмири осеби ДНК, ки ҳангоми репликатсия рух медиҳанд, заруранд. Ин давра ба замоне рост меояд, ки дар он E2F ифода меёбад ва дар vivo ба генҳое, ки дар репликатсия ва роҳҳои таъмири ДНК иштирок мекунанд, пайваст мешавад.

Моделе, ки нақши густурдаи E2F-ро дар якчанд марҳилаҳои сикли ҳуҷайра ва дар нуқтаҳои назорати сершумор нишон медиҳад. Хати ғафси уфуқӣ давраи ҳуҷайраро нишон медиҳад. Илова ба танзими якчанд генҳои танзимкунандаи давраи ҳуҷайра, аз ҷумла онҳое, ки циклинҳо, CDKҳо, дигар E2Fҳо ва оилаи pRB-ро рамз мекунанд, E2F4 бо генҳои дар G иштироккунанда алоқаманд аст.1 ва Г2 Нуқтаҳои назорати зарари ДНК, репликатсияи ДНК ва таъмири ДНК. E2F4 инчунин ба генҳо пайваст мешавад, ки барои мусоидат ба конденсатсия ва сегрегатсияи хромосомаҳо ва инчунин нуқтаи назорати шпиндель фаъолият мекунанд. Гарчанде ки E2F1 якчанд генҳои дар митоз иштирокдоштаро мепайвандад, аксари генҳо бо ин омили транскрипсия дар таҳлили макони мо дар роҳҳои репликатсия ва таъмири ДНК ҷамъ шудаанд.

Таҷрибаҳои охирини экспрессияи генҳо инчунин як қатор генҳоро муайян карданд, ки дар апоптоз, сигнализатсия ва фарқият иштирок мекунанд (Мюллер ва дигарон 2001). Сарфи назар аз он, ки порчаҳои промоутер барои як зермаҷмӯи ин генҳо дар микросиклии ҳуҷайраҳои мо муаррифӣ шудаанд, бояд қайд кард, ки ин генҳо дар экрани микроаррейи мо муайян карда нашудаанд. Асоси ин ихтилоф дар айни замон маълум нест, гарчанде протоколҳои таҷрибавии дивергенти, аз ҷумла истифодаи хатҳои гуногуни ҳуҷайра ва эктопикӣ ва эндогении E2Fs, метавонанд ихтилофро ҳисоб кунанд.


Натиҷаҳо

Fission Yeast sld3 + барои афзоиши ҳуҷайраҳо муҳим аст

Мо як протеини гипотетикиро (GenBank CAA90850.2) дар махзани геноми хамиртуруши тақсимшавӣ муайян кардем. Ин сафеда 14% ҳувият ва 24% шабоҳатро бо хамиртуруши шукуфтани Sld3 тақсим мекунад (Расми 1B). Гене, ки сафедаро рамзгузорӣ мекунад, номида шуд sld3 + , ҳамчун ҳамтои эҳтимолии хамиртуруши шукуфтани SLD3. Дарsld3 + полипептиди 699-кислотаи аминокислотаро бо массаи ҳисобшудаи молекулавии ~79 кДа рамзгузорӣ мекунад. Ин сафеда дорои мотивҳои хоси сафедаи сафеда надорад, ба истиснои мотивҳои печонидашудаи печдор дар минтақаҳои 142–165 ва 253–341 мавқеъҳои аминокислотаҳо (Расми 1А).

Расми 1. Сохтори С. помбе SpSld3. (A) Намоиши схемавии SpSld3 нишон дода шудааст. Қуттиҳои сояафкан минтақаҳои печонидашудаеро нишон медиҳанд, ки аз ҷониби барномаи COILS пешбинӣ шудааст. Ситорачаҳо мавқеъи аминокислотаҳоеро, ки аз ҷониби онҳо тағйир ёфтаанд, нишон медиҳанд sld3-10,-41, ва -52 мутатсияҳо. $B) пайдарпаии пешбинишудаи аминокислотаҳо бо пайдарпаии аминокислотаҳо мувофиқат мекунанд S. cerevisiae Sld3, бо истифода аз усули ClustalW. Кислотаҳои аминокислотаҳои якхела сояафкананд ва аминокислотаҳои аминокислотаҳо бо қуттии қуттӣ канда мешаванд. Ситорачаҳо мавқеи аминокислотаҳоеро, ки аз ҷониби онҳо тағир дода шудаанд, нишон медиҳандsld3-10, -41, ва -52мутатсияҳо, ки дар матн тавсиф шудаанд.

Мо яке аз онҳоро иваз кардем sld3 + нусхаҳо дар аура − диплоид боsld3::ura4 + . Споруляция ва тақсимоти тетрадиsld3 + /sld3::ura4гетеродисрупант ду спораи қобили ҳаёт ва ду қаламчаи марговар дод ва ҳамаи қаламчаҳои қобили ҳаёт Ura - буданд. Барои тасдиқи он, ки марговар аз сабаби вайрон шудани он будsld3 + ,sld3 + /sld3::ura4 + диплоидҳое, ки бо плазми pSLD3 табдил ёфтаандsld3 + ген спора шуд. Дисекцияи тетрад се ва чор спораи қобили ҳаёт, аз ҷумла спораҳои Ura + дод. Ҳамин тариқ, баsld3 + дар ҳақиқат барои афзоиши ҳуҷайра муҳим аст.

Мутантҳои ба ҳарорат ҳассос sld3 дар репликатсияи ДНК нуқсон доранд

Барои таҳқиқи нақши муҳими Sld3 дар афзоиши ҳуҷайра, мо мутантҳои ба ҳарорат ҳассосро ҷудо кардем. sld3. Мутацияҳо тавассути PCR ба порчае ворид карда шуданд, киsld3 + ваур4 + генҳо ва маҳсулоти PCR барои табдил додани а ура − штамми гаплоид. Дар байни 3000 Ura + трансформантҳо, ки дар ҳарорати 23 ° C парвариш карда шудаанд, се мутант, ки дар 36 ° C афзоиш намеёфтанд, ҷудо карда шуданд. Афзоиши мутантҳо дар ҳарорати маҳдуд тавассути табдилдиҳӣ бо pSLD3 барқарор карда шуд, ки ин пешниҳод мекунад, ки sld3ген мутатсия дорад.

Муайян кардани пайдарпаии нуклеотидҳои мутант sld3генҳо нишон доданд, ки боқимондаи кислотаи глутамикӣ дар мавқеи 338 бо глицин иваз карда мешавад. sld3-10, триптофан дар мавқеи 310 ва аргинин дар sld3-52, ва серин дар мавқеи 153 ва лейцин дар мавқеи 309 бо лейцин ва пролин, дар sld3-41. Бояд қайд кард, ки ҳамаи ин тағиротҳо дар минтақаҳои пешгӯишудаи печонидашуда ҷойгиранд, гарчанде ки ин аминокислотаҳо дар байни хамиртуруши шукуфтаи Sld3 ва SpSld3 нигоҳ дошта намешаванд, ба истиснои яке аз ду макон дар sld3-41 (Расми 1А).

Мо аввал афзоиши онро дида баромадем sld3-10 дар ҳарорати маҳдудкунанда. Афзоиши шумораи ҳуҷайраҳо дар давоми 2-4 соат дар 36 ° C ба таъхир афтод ва пас аз 6 соат боздошт шуд (Расми 2A). Зиндагии ҳуҷайра дар 6 соат то ~ 40% кам шуд (Тасвири 2B). Барои муайян кардани таъсири sld3-10мутация дар репликатсияи ДНК, мо мундариҷаи ДНК-ро дар ҳарорати маҳдудкунанда бо истифода аз цитометрияи ҷараён таҳлил кардем. sld3-10ҳуҷайраҳо, ки дар аввал ДНК-и 2С ҳамчун навъи ваҳшӣ доранд, пас аз 2 соат дар ҳарорати 36°С ҳуҷайраҳои дорои ДНК 1С-ро ба вуҷуд оварданд ва шумораи ин ҳуҷайраҳо дар 4 соат зиёд шуд (расми 2С). Илова бар ин, ҳуҷайраҳои дорои мазмуни DNA <1C дар 6 соат пайдо шуданд. Ду мутант дигар,sld3-41 ва sld3-52, инчунин ҳуҷайраҳои дорои мазмуни ДНК 1C дар ҳарорати маҳдудкунанда ҷамъ шудаанд (маълумоти нашрнашудаи мо). Аз ин рӯ, ДНК-и хромосома дар ин мутантҳо такрор намешавад. SpSld3 аз афташ барои репликатсияи ДНК ё барои пешрафти G1-S давраи ҳуҷайра лозим аст.

Расми 2. Афзоиши ба ҳарорат ҳассос sld3-10. Навъи ваҳшӣ ба таври экспоненсиалӣ афзоиш меёбад (972) ва sld3-10 ҳуҷайраҳои дар ҳарорати 23 ° C ба 36 ° C кӯчонида шуданд ва ҳуҷайраҳои ҷамъоварӣ дар нуқтаҳои вақти муайяншуда таҳлил карда шуданд. Рақами ҳуҷайра (A) ва қобилияти мавҷудияти ҳуҷайра (B) нишон дода шудааст. (C) Профилҳои цитометрии ҷараён нишон дода шудаанд. $D) Пешгирии sld3-10 бо миқдори зиёди ген sna41 + нишон дода мешавад. Дар sld3-10 ҳуҷайраҳои бо вектор, pSLD3 ё pSNA41 плазми табдилшуда дар плитаҳои EMM2 рахҳо кашида шуданд ва дар 23 ё 36 ° C инкубатсия карда шуданд. $E) Пешгирии sna41-1 аз ҷонибиsld3 + нишон дода мешавад. Логарифмикӣ афзоиш меёбад sna41-1 Ҳуҷайраҳои дорои вектор, pSNA41 ё pSLD3 плазмид пас аз разрядҳои пайдарпай пайдо шуданд ва дар 25 ё 37 ° C инкубатсия карда шуданд.

Бо ранг кардани 4,6-диамидино-2-фенилиндол, мо мушоҳида кардем, ки тақрибан 10%sld3-10 ҳуҷайраҳо дорои ядрои нобаробар тақсимшуда ё ядрои тақсимнашуда, ки пас аз 6 соат дар 36 ° C аз тарафи септум ҷудо карда шудаанд, аммо ин гуна ҳуҷайраҳо дар намуди ваҳшӣ мушоҳида карда нашуданд (маълумоти нашрнашудаи мо). Ин ҳуҷайраҳо ба ҳуҷайраҳои дорои мазмуни ДНК <1C дар таҳлили цитометрияи ҷараён мувофиқат мекунанд ва онҳо эҳтимолан дар натиҷаи тақсимоти ядроӣ бе анҷоми репликатсияи ДНК ба вуҷуд омадаанд. Ин натиҷаҳо нишон медиҳанд, ки sld3-10 ҳуҷайраҳо дар тавлиди сигнали гузариши S-M нуқсон доранд.

Хамиртуруши шукуфтан SLD3 бо ирси мутақобила дорадSLD4/CDC45 (Камимура ва дигарон., 2001). Барои тафтиши чунин муносибатхои байниsld3 + ваsna41 + ген рамзгузории SpCdc45,sld3 мутантҳо бо интиқоли плазмиди баланд нусхабардорӣ табдил дода шуданд sna41 + . Афзоишиsld3-10, -41, ва -52 дар харорати махдудкунанда аз тарафиsna41 + плазмид (Расми 2D маълумоти нашрнашудаи мо). Дар озмоиши мутақобила, афзоиши sna41-1, мутант ба ҳарорат ҳассос аз sna41, тавассути табдилдиҳӣ бо pSLD3 барқарор карда шуд (Расми 2E). Аз ин рӯ, байни ҳамкории генетикии қавӣ вуҷуд дорад sld3 + ваsna41 + . Якҷоя бо шабоҳати пайдарпай, sld3 + ба назар чунин мерасад, ки ҳамтои хамиртуруши шукуфта SLD3.

Таъсири мутақобилаи аз давраи ҳуҷайра вобастаи SpSld3 бо SpCdc45 ва SpMcm6

Дар асоси таъсири мутақобилаи генетикии байниsld3 + ваsna41 +, мо мутақобилаи ҷисмониро байни SpSld3 ва SpCdc45 тафтиш кардем. Ҳуҷайраҳое, ки SpCdc45-Myc ё ҳарду SpCdc45-Myc ва SpSld3-FLAG аз маҳалҳои хромосомаро ифода мекунанд, дар марҳилаи аввали S тавассути илова кардани гидроксиуреа (HU), ки синтези дезоксирибонуклеотидҳоро бозмедорад, боздошт шуданд. SpSld3 дар ҳузури DNase I иммунопреципиатсия карда шуд ва ин копреципиатсияи ғайриспесифии тавассути ДНК миёнаравиро коҳиш медиҳад. SpCdc45 аз ҳуҷайраҳои ифодакунандаи SpSld3-FLAG (Расми 3A, хати 6), аммо на аз штамми бетағйир (қатори 3) ё бе антитело зидди FLAG (хати 5) якҷоя карда шуд. Дар озмоиши мутақобила бо истифода аз антиденои зидди SpCdc45, SpSld3-FLAG бо SpCdc45 якҷоя карда шуд (Расми 3A, хати 8). Ин мушоҳидаҳо маънои онро доранд, ки SpSld3 дар марҳилаи аввали S бо SpCdc45 алоқаманд аст.

Расми 3. Коиммунопреципиатсияи SpCdc45 ва SpMcm6 бо SpSld3 дар марҳилаҳои G1–S. (A) Ҳуҷайраҳое, ки ҳам SpSld3-FLAG5 ва ҳам SpCdc45-Myc9 (қаторҳои 4-6 ва 7 ва 8) ё танҳо SpCdc45-Myc9 (қаторҳои 1-3) ифода мекунанд, дар ҳузури 10 мм HU барои 3 соат дар 30 ° C парвариш карда шуданд. ки дар давраи S ибтидой дастгир карда шавад. Экстрактҳои тамоми ҳуҷайраҳо (қаторҳои 1 ва 4) омода карда шуданд ва ба иммунопреципиатсия бо антителоҳои зидди FLAG (қаторҳои 3 ва 6), табобати тақаллубӣ бидуни антитело (қатори 2 ва 5), бо зардоби муқаррарии харгӯш (хати 7) ё зидди- Антитело SpCdc45 (хати 8). Дар муқоиса бо воридот даҳ маротиба зиёдтар иммунопреципитатҳо барои blotting ғарбӣ бо антителоҳои зидди FLAG ва зидди Myc истифода шуданд. Мо SpSld3-FLAG-ро бе иммунопреципиатсия ошкор накардем, шояд аз он сабаб, ки ин миқдор аз ҳудуди муайян камтар буд. (Б) cdc25-22 ҳуҷайраҳои ифодакунандаи SpSld3-FLAG5 ва SpCdc45-Myc9 барои 4 соат дар 36 ° C боздошт ва сипас дар 25 ° C озод карда шуданд. Дар лаҳзаҳои нишондодашуда иқтибосҳо бо антиденои зидди FLAG иммунопреципиатсия карда шуданд. SpSld3-FLAG, SpMcm6 ва SpCdc45 дар иммунопреципитатҳо тавассути иммуноблоттинг таҳлил карда шуданд. Прогресси сикли ҳуҷайраҳо аз рӯи фоизи ҳуҷайраҳои дорои септум (индекси септатсионӣ), тавре ки дар поён панелҳо нишон дода шудааст, назорат карда шуд. Дар хамиртуруши тақсимшавӣ, ситокинез тақрибан чоряки давраи ҳуҷайра дертар аз тақсимоти ядроӣ рух медиҳад (Алфа) ва дигарон., 1993). Ҳамин тариқ, индекси септатсионӣ тақрибан ҳангоми гузариши G1-S дар ҳуҷайраҳои навъи ваҳшӣ дар шароите, ки мо истифода мебарем, ҳадди аксар мешавад. (C) SpSld3 бо истифода аз антиденои зидди FLAG аз иммунопреципитатсия карда шуд nda3-KM311 sld3-flag5 ҳуҷайраҳо барои 4 соат дар 20 ° C парвариш карда мешаванд (хати 1-4). Иммунопреципитатҳо бо CIP дар ҳузури (қатори 4) ё набудани (хати 3) ингибиторҳои фосфатаза коркард карда шуданд.

Баъдан, мо ассотсиатсияи SpSld3 бо SpCdc45-ро дар давоми давраи ҳуҷайра тафтиш кардем. Ҳассос ба ҳарорат cdc25-22 ҳуҷайраҳои ифодакунандаи SpSld3-FLAG ва SpCdc45-Myc дар сарҳади G2/M ҳабс карда шуданд ва дар ҳарорати иҷозатдодашуда ба сикли ҳуҷайра озод карда шуданд. Таҳлили SpSld3-иммунопреципитатҳо (IPs) тавассути blotting ғарбӣ нишон дод, ки SpCdc45 пас аз озодшавӣ 80-120 дақиқа якҷоя мешавад (Расми 3B). Вақти боришот чанде пас аз афзоиши индекси септатсионӣ буд, ки ин нишон медиҳад, ки SpSld3 бо SpCdc45 асосан дар марҳилаи S алоқаманд аст. Аз тарафи дигар, SpMcm6 дар SpSld3-IP дар 60-100 дақиқа ошкор карда шуд, ки ин нисбат ба SpCdc45 пештар буд. SpMcm7 инчунин бо SpSld3 дар ҳамон даврае, ки бо SpMcm6 (маълумоти нашрнашудаи мо) ҷамъ шуда буд. SpSld3 эҳтимолан бо сафедаҳои MCM пеш аз ассотсиатсия бо SpCdc45 алоқаманд аст.

SpSld3 ҳамчун бандҳои паҳншуда дар тӯли 0-60 дақиқа пас аз озод шудан аз блоки G2/M муҳоҷират кард, дар ҳоле ки он як банди тез бо ҳаракати баландтар дар 80 дақиқа ва баъдтар вақт ташкил дод. Барои тафтиш кардани эҳтимолияти сусттар шудани ҳаракати SpSld3 аз фосфоризатсия, SpSld3 аз иммунопреципитация шуд. nda3-KM311 sld3-flag5 ҳуҷайраҳои боздоштшуда дар марҳилаи M (Hiraoka ва дигарон., 1984) бо CIP инкубатсия карда шуд. Ин муолиҷаи фосфатаза як банди тези дорои ҳаракати баландтар дод (Расми 3C, хати 3), дар ҳоле ки бандҳои оҳиста муҳоҷираткунанда дар ҳузури ингибиторҳои фосфатаза боқӣ монданд (Расми 3C, хати 4). Ҳамин тариқ, SpSld3 дар ҳуҷайраҳои ҳабсшудаи M-фаза фосфоронида мешавад. Ба назар чунин менамояд, ки банди баландтари ҳаракат дар марҳилаи S мушоҳида мешавад (Расми 3B) шакли гипофосфоризатсияшуда аст.

Маҳаллисозии SpSld3 дар пайдоиши репликатсияи хромосомӣ дар марҳилаҳои G1-S

SpMcm6 ба пайдоиши такрорӣ дар марҳилаҳои G1-S локализатсия мешавад (Огава ва дигарон., 1999). Азбаски SpSld3 бо SpMcm6 алоқаманд аст, мо пурсидем, ки оё SpSld3 бо пайдоиши такрорӣ дар марҳилаи мушаххаси давраи ҳуҷайра алоқаманд аст. Мо таҳлилҳои хроматин CHIP кардем (Огава ва дигарон., 1999) бо истифода cdc25-22 ҳуҷайраҳои ифодакунандаи SpSld3-FLAG, мувофиқи дар боло тавсифшуда ҳамоҳанг карда мешаванд. Ҳуҷайраҳо бо формальдегид дар нуқтаҳои вақти нишондодашуда пайваст карда шуданд ва порчаҳои ДНК бо SpSld3-FLAG тавассути иммунопреципиатсия барқарор карда шуданд. Ассотсиатсияи SpSld3 тавассути PCR барои пайдоиши репликатсияи хромосомӣ таҳлил карда шуд ars2004 (Окуно ва дигарон., 1997), дар якҷоягӣ бо ду минтақаи ғайри ARS. Се порча ба андозаи шабеҳ аз ДНК-и умумии ҳуҷайравӣ, ки ҳамчун қолаб истифода мешаванд, тақвият дода шуданд (Расми 4А). Аз тарафи дигар, вақте ки ДНК-и иммунопреципиатсия ҳамчун қолаб истифода мешуд,ars2004 порча дар давоми 80-120 дақиқа пас аз озод шудан ба таври афзалиятнок тақвият дода шуд (Расми 4A) ва ин давра ба марҳилаҳои G1-S мувофиқат мекард, ки тавассути афзоиши индекси септатсионӣ назорат карда мешавад. Афзалиятноккунии афзояндаи ars2004 порча аз FLAG бо тамғаи SpSld3 ва муолиҷаи байнисоҳавӣ вобаста буд (маълумоти нашрнашудаи мо). Ин мушоҳидаҳо маънои онро доранд, ки SpSld3 боars2004 пайдоиш дар марҳилаҳои G1-S.

Расми 4. SpSld3 бо ДНК-и пайдоиш дар марҳилаҳои G1–S алоқаманд аст.(A) cdc25-22 ҳуҷайраҳои ифодакунандаи SpSld3-FLAG5 ва SpCdc45-Myc9 ҳамоҳанг карда шуданд, тавре ки дар расми 3B тасвир шудааст. Дар ҳар 20 дақиқа ҳуҷайраҳо бо формальдегид ва порчаҳои ДНК, ки бо SpSld3-FLAG алоқаманданд, бо антителоҳои зидди FLAG иммунопреципитатсия карда шуданд. Дар ars2004 ва минтақаҳои ғайриARS аз ДНК-и умумии ҳуҷайравӣ (Total) ва ДНК-и иммунопреципиатсияшуда тавассути истифодаи ars2004 ва ду маҷмӯаи праймери ғайри ARS ва ба электрофорези гели агарозӣ дучор мешаванд. Фоизи ҳуҷайраҳои дорои септум дар зер нишон дода шудаанд. (Б) cdc10-V50 sld3-flag5 ҳуҷайраҳои дар 23 ° C парваришшуда барои 3 соат дар 36 ° C инкубатсия карда шуданд. Ҳуҷайраҳо ба хроматин-иммунопреципиатсия бо антителоҳои зидди FLAG, ки дар боло тавсиф шудаанд, дучор шуданд. Профилҳои цитометрии ҷараён дар 0 ва 3 соат нишон дода шудаанд (аз чап). (C) hsk1-89 sld3-flag5 ҳуҷайраҳо ба 30 ° C кӯчонида шуданд ва барои 3 соат инкубатсия карда шуданд. Ҳуҷайраҳо ба хроматин-иммунопреципиатсия бо антиденои зидди SpMcm6 ё антиденои зидди FLAG дучор шуданд. Профили цитометрии ҷараён нишон медиҳад, ки тақрибан нисфи ҳуҷайраҳо ДНК-и такрорнашаванда доранд (аз чап).

Барои дақиқтар омӯхтани вақти пайдоиш-ассотсиатсияи SpSld3, мо бо истифода аз санҷишҳои ChIP анҷом додем. cdc10 штамм, ки дар он Cdc18 ё Cdt1 ифода намешавад ва сафедаҳои MCM ба хроматин дар ҳарорати маҳдудкунанда бор карда намешаванд (Огава ва дигарон., 1999 Нишитани ва дигарон., 2000). cdc10-V50 ҳуҷайраҳое, ки SpSld3-FLAG-ро ифода мекунанд, дар 36 ° C барои 3 соат инкубатсия карда шуданд, то давраи ҳуҷайра дар марҳилаи аввали G1 боздошта шаванд. Дар ars2004 порча аз иммунопреципитатҳои SpSld3 ба таври афзалиятнок тақвият дода нашудааст (Расми 4B). Барои санҷидани он, ки таҳлили ChIP барои ҳуҷайраҳои дар ҳарорати баланд инкубатсияшуда кор мекунад, cdc25-22 ҳуҷайраҳои аз сарҳади G2/M озодшуда дар марҳилаи аввали S дар ҳузури HU ҳабс карда шуданд ва сипас дар 36 ° C барои 1 соат инкубатсия карда шуданд. Дарars2004 порча аз ДНК бо SpSld3 иммунопреципиатсияшуда ба таври интихобӣ тақвият дода шуд, то ба андозае, ки ба намунае, ки дар 36 ° C инкубатсия нашудааст (маълумоти нашрнашудаи мо). Ин натиҷаҳо нишон медиҳанд, ки SpSld3 ба пайдоиши такрорӣ дар он бор карда нашудаастcdc10-нуқтаи боздошт дар марҳилаи G1.

Сипас мо ассотсиатсияи пайдоиши SpSld3-ро дар hsk1-89мутант, мутант ба ҳарорат ҳассос Hsk1 киназа (Такеда ва дигарон., 2001). Хабар дода шуд, ки фаъолияти DDK барои боркунии хроматини MCM талаб карда намешавад, аммо барои боркунии Cdc45 дарКсенопус иқтибосҳои тухм (Jares and Blow, 2000 Walter, 2000). Ҳамин тариқ, дар hsk1-89 Интизор меравад, ки давраи ҳуҷайра пеш аз оғоз, дар охири марҳилаи G1 боздошта шавад. hsk1-89 ҳуҷайраҳои мутант, ки SpSld3-FLAG-ро ифода мекунанд, дар ҳарорати маҳдудкунанда (30 ° C) барои 2 соат инкубатсия карда шуданд ва пас аз санҷиши ChIP гузаронида шуданд. Дарars2004 порча аз SpMcm6-IPs афзалиятнок тақвият дода шуд (Расми 4C), бинобар ин тасдиқ мекунад, ки DDK барои боркунии MCM дар хамиртуруши тақсимшавӣ лозим нест. Афзоиши мушаххасиars2004 порча бо истифода аз SpSld3-IP ҳамчун қолаб мушоҳида карда нашуд (Расми 4C). Зеро фаъолияти DDK аз ҷониби кам карда мешавадhsk1-89 мутация (Такеда ва дигарон., 2001), ассотсиатсияи SpSld3 бо пайдоиши такрорӣ аз фаъолияти DDK вобаста аст. SpSld3 бо пайдоиш дар марҳилаи охири G1, пас аз ё дар нуқтаи иҷрои DDK алоқаманд аст.

Боркунии хроматини SpCdc45 бо мутатсияи sld3-10 халалдор шудааст

Барои муайян кардани нақши SpSld3 дар оғози репликатсияи ДНК, мо таҳқиқ кардем, ки оё sld3-10 Мутация ба боркунии MCM ва SpCdc45 ба хроматин таъсир мерасонад. Мо аввал ассотсиатсияи сафедаҳои MCM ва SpCdc45-ро бо хроматин дар пешрафти давраи ҳуҷайра тафтиш кардем. Мо истифода бурдем cdc25-22 ҳуҷайраҳои ифодакунандаи SpCdc45-Myc ва SpSld3-FLAG тавре ки дар боло тавсиф шудаанд, ҳамоҳанг карда мешаванд. Дар лаҳзаҳои зикршуда, фраксияи бо хроматин ғанишуда аз фраксияи ҳалшаванда-протеин ҷудо карда шуд ва тавассути blotting Western таҳлил карда шуд. Тавре ки дар расми 5А нишон дода шудааст, SpOrc4, зербахши SpORC, дар фраксияи бо хроматин бойшуда дар тамоми давраи ҳуҷайра мавҷуд буд. SpMcm6 бо хроматин аз 40 то 120 дақиқа пас аз озодшавӣ алоқаманд буд, ки ба марҳилаҳои G1-S мувофиқат мекунад. SpMcm7 дар фраксияи бо хроматин бойшуда дар ҳамон даврае, ки бо SpMcm6 (маълумоти нашрнашудаи мо) ошкор карда шуд. Аз тарафи дигар, SpCdc45 дар фраксияи бо хроматин бойшуда дар 60 дақиқа пайдо шуд, дар 80-100 дақиқа пас аз озод шудан ба авҷи худ расид ва сипас коҳиш ёфт (Расми 5А). Аз ин рӯ, SpCdc45 бо хроматин нисбат ба сафедаҳои MCM дертар пайваст мешавад. Мо SpSld3-ро дар фраксияи бо хроматин ғанишуда ё дар фраксияи ҳалшаванда ошкор накардем, шояд аз он сабаб, ки миқдори сафеда дар ин фраксияҳо аз маҳдудияти ошкор камтар буданд (маълумоти нашрнашудаи мо).

Расми 5. Ассотсиатсияи SpCdc45 бо хроматин дар sld3-10 мутант. (A) Ассотсиатсияи аз давраи ҳуҷайра вобастаи SpCdc45 бо хроматин нишон дода шудааст. Дарcdc25-22 ҳуҷайраҳои ифодакунандаи SpSld3-FLAG5 ва SpCdc45-Myc9 ҳамоҳанг карда шуданд, тавре ки дар расми 3B тасвир шудааст.Ҳуҷайраҳое, ки дар вақтҳои зикршуда ҷамъ оварда шудаанд, ба фраксияи хроматин дучор шуданд. Супернатант (S) ва фраксияи бо хроматин бойшуда (P) тавассути blotting ғарбӣ бо антителоҳои зидди SpMcm6, анти-SpCdc45 ва зидди SpOrc4 таҳлил карда шуданд. Индекси септатсионӣ дар поёни панелҳо нишон дода шудааст. $B) Навъи вањшї ва sld3-10 ҳуҷайраҳое, ки SpCdc45-Myc9 ва SpOrc1-FLAG5-ро ифода мекунанд, ба марҳилаи сабт дар 23 ° C парвариш карда шуданд. Дарsld3-10 Пас аз он ҳуҷайраҳо дар 36 ° C барои 3 соат инкубатсия карда шуданд. Ҳуҷайраҳои навъи ваҳшӣ барои 3 соат дар 36 ° C дар ҳузури 12 mM HU барои боздошт дар марҳилаи аввали S инкубатсия карда шуданд. Натиҷаҳои цитометрияи ҷараён нишон дода шудаанд. $C) Ассотсиатсияи SpCdc45 бо хроматин дарsld3-10 муоина карда шуд. Лизатҳо ба фраксияи хроматин дучор шуданд. Иқтибосҳои пурраи ҳуҷайра (WCE), супернатант (суп) ва фраксияи бо хроматин бойшуда (ppt) тавассути иммуноблот бо анти-FLAG (боло), анти-SpMcm6 ва anti-Myc (миёна) ва анти-Mcm7 (поён) таҳлил карда шуданд. антитело. (D) Ассотсиатсияи SpMcm6 бо SpCdc45 дар sld3-10 дар ҳарорати маҳдуд санҷида шуд. Навъи ваҳшӣ ва sld3-10ҳуҷайраҳо дар 36 ° C инкубатсия карда шуданд, тавре ки дар В. Лизатҳои ҳуҷайра бо хунобаи муқаррарии харгӯш (IP-и тақаллубӣ) ё антиденои зидди SpMcm6 иммунопреципитатсия карда шуданд. Иммунопреципитатҳо тавассути иммуноблот бо антителоҳои зидди SpMcm6 ва зидди Myc таҳлил карда шуданд.

Барои тафтиш кардани таъсири он sld3-10 мутатсия дар робита бо SpCdc45 бо хроматин, ҳуҷайраҳои мутант, ки SpOrc1-FLAG ва SpCdc45-Myc-ро ифода мекунанд, дар 36 ° C барои 3 соат инкубатсия карда шуданд. Ҳамчун назорат, ҳуҷайраҳои навъи ваҳшӣ дар марҳилаи аввали S тавассути инкубатсия дар 36 ° C барои 3 соат дар ҳузури HU боздошт шуданд. Цитометрияи ҷараён нишон дод, ки мутант ва штаммҳои навъи ваҳшӣ бо HU коркардшуда ҳуҷайраҳоро бо мазмуни ДНК 1С ҷамъ кардаанд (Расми 5В). Натиҷаҳои blotting ғарбӣ нишон доданд, ки тақрибан аз се як ҳиссаи SpOrc1 ва як ҳиссаи SpMcm6, SpMcm7 ва SpCdc45 дар фраксияи хроматин ғанишудаи ҳуҷайраҳои навъи ваҳшии бо HU боздоштшуда буданд (Расми 5C). Баръакси ин, SpCdc45 дар фраксияи бо хроматин бойшуда ошкор карда нашудааст. sld3-10иқтибосҳо, дар ҳоле ки SpOrc1, SpMcm6 ва SpMcm7 ҳамчун навъи ваҳшии HU боздоштшуда ошкор карда шуданд (Расми 5C). Бинобар ин, sld3-10мутант дар бор кардан ё нигоҳдории SpCdc45 ба хроматин нуқсон дорад. Мувофиқи ин натиҷаҳо, SpCdc45 бо SpMcm6 дар ҳарорати маҳдудкунандаи sld3-10(Расми 5D). Ин натиҷаҳо нишон медиҳанд, ки SpSld3 барои боркунии SpCdc45 ба RC-ҳои пеш аз пайдоиши такрорӣ лозим аст.

Талаботи SpSld3 дар марҳилаи S

Азбаски сафедаҳои MCM ва Cdc45 барои дароз кардани репликатсияи ДНК лозиманд (Labib ва дигарон., 2000 Терсеро ва дигарон., 2000), мо муайян кардем, ки оё SpSld3 пас аз ворид шудан ба марҳилаи S лозим аст. Навъи ваҳшӣ ва sld3-10 ҳуҷайраҳо аз ҷониби HU дар 23 ° C боздошт ва сипас дар 36 ° C барои ғайрифаъол кардани протеини мутант инкубатсия карда шуданд. Ҳангоми хориҷ кардани HU дар 36 ° C, мундариҷаи ДНК дар ҳуҷайраҳои навъи ваҳшӣ дар давоми 30 дақиқа аз 1С то 2С зиёд шуд (Расми 6B). Назар ба, sld3-10ҳуҷайраҳо мазмуни ДНК-ро пас аз баровардан хеле суст зиёд карданд. Гарчанде ки мазмуни ДНК sld3-10 ҳуҷайраҳо пас аз 3 соат тақрибан ба 2С ДНК афзоиш ёфтанд, шумораи ҳуҷайраҳо зиёд нашуд (Расми 6С), эҳтимол аз он ки синтези ДНК ба анҷом нарасидааст, тавре ки қуллаи васеъ дар натиҷаҳои flow-cytometry мушоҳида мешавад. Кафомонии шадиди репликатсияи ДНК метавонад аз нуқсон дар дарозшави ба ғайр аз нуқсон дар оғози пайдоиши дер оташ, ки дар ҳуҷайраҳои боздоштшудаи HU фаъол нашуда буд, натиҷа диҳад. Аз даст додани тадриҷии қобилият пас аз озодшавӣ (Расми 6D) метавонад аз сабаби камбудиҳои бебозгашт дар дарозшавии репликатсияи ДНК, ба монанди синтези аберранти ДНК бошад.

Расми 6. SpCdc45 аз хроматини ҳабсшудаи S-фаза ҷудо шудааст. sld3-10. $A) Навъи ваҳшӣ ваsld3-10 ҳуҷайраҳои ифодакунандаи SpOrc1-FLAG5 ва SpCdc45-Myc9 барои 4 соат дар ҳузури 10 mM HU дар ҳарорати иҷозатдода (23 ° C) парвариш карда шуданд ва сипас дар 36 ° C барои 1 соат инкубатсия карда шуданд. Ҳуҷайраҳо шуста ва ба муҳити пурраи бе HU дубора суспензия карда шуданд. $A) Нақшаи таҷриба нишон дода шудааст. (B) Мазмуни ДНК-и ҳуҷайраҳо пас аз раҳо шудан аз ҳабси HU тавассути цитометрияи ҷараён таҳлил карда шуд. Рақамҳои ҳуҷайраҳо (C) ва қобилияти ҳаёт, ки тавассути воҳидҳои колонияҳо/рақами ҳуҷайраҳо (D) ба даст оварда шудаанд, нишон дода шудаанд. (E) Фраксияи хроматин аз ҳуҷайраҳои боздоштшудаи HU пеш аз ва баъд аз инкубатсия барои 1 соат дар 36 ° C омода карда шуд. Иқтибосҳои пурраи ҳуҷайра (W), супернатант (S) ва фраксияи бо хроматин бойшуда (P) тавассути иммуноблот бо анти-FLAG барои SpOrc1-FL (боло), анти-SpMcm6 (миёна) ва антителоҳои зидди Myc барои SpCdc45 таҳлил карда шуданд. -Myc (поён). (F) Тасвирҳо дар E бо истифода аз таҳлилгари тасвири LAS1000 плюс (Fuji Film, Токио, Ҷопон) миқдорбандӣ карда шуданд ва таносуби SpMcm6/SpOrc1 ва SpCdc45/SpOrc1 оварда шудаанд.

Барои таҳқиқи нақши SpSld3 дар марҳилаи S, мо таъсири онро тафтиш кардем sld3-10 мутатсия дар устувории ассотсиатсияи хроматини сафедаҳои MCM ва SpCdc45. Дар ҳуҷайраҳои навъи ваҳшӣ, ки бо HU боздошт шудаанд, миқдори бо хроматин алоқаманд SpOrc1, SpMcm6 ва SpCdc45 пас аз инкубатсияи минбаъда дар 36 ° C барои 1 соат бетағйир монданд (Расми 6E, хати 6). Баръакс, дар sld3-10 ҳуҷайраҳо, миқдори SpCdc45, ки бо хроматин алоқаманд аст, тавассути инкубатсия дар 36 ° C коҳиш ёфт (Расми 6E, хати 12). Миқдори SpMcm6 дар фраксияи хроматин ба таври назаррас таъсир нарасонд, тавре ки бо миқдори муайянкунии сигналҳои бофташуда нишон дода шудааст (Расми 6F). Ин натиҷаҳо нишон медиҳанд, ки SpSld3 барои нигоҳ доштани SpCdc45 дар хроматин дар марҳилаи S лозим аст.


Натиҷаҳо

Тарҳрезии таҷрибавӣ барои муайян кардани тақсимоти тетрамер дар макони ҷудогонаи геномӣ.

Танзимоти таҷрибавии мо ду версияи ба таври дифференсиалӣ нишондодашудаи H3-ро истифода мебарад, ки дар зери промоутерҳои индуксивӣ ҷойгир карда шудаанд ва барои ташкил кардани гистонҳои кӯҳна ва нав танзим карда мешаванд (расми 1).А). H3-и кӯҳна се нусхаи гликопротеини VSV (H3-VSVG) дорад ва аз он ифода карда мешавад. MET3 промоутер, дар ҳоле ки H3 бо ду барчаспҳои HA (H3–HA), аз ГАЛ1 промоутер, ҳамчун гистони нав фаъолият мекунад. Плазмидҳое, ки дорои ҳар як версияи индуксионии C-терминалӣ H3 мебошанд, якҷоя ба як S. cerevisiae штамм, ки генҳои эндогении H3 надоранд. Ҳар як версияи барчаспшудаи H3 қодир аст, ки қобилиятро дастгирӣ кунад, вақте ки ҳамчун нусхаи ягонаи H3 ифода шуда, кори онро тасдиқ мекунад. Штамми иловагии назорати мусбӣ тавлид шуд, ки дар он ҳарду версияи барчаспшудаи H3 таҳти назорати промоутери модарӣ қарор доранд ва ба ин васила якҷоя ифода карда мешаванд (расми 1).Б.).

Тарҳрезии таҷрибавӣ. (А) Штамми таҷрибавии YKY69 генҳои эндогении H3 надорад ва дорои ду плазмидаи центромерӣ мебошад, ки H3-VSVG-ро аз метионин репрессивӣ ифода мекунанд MET3 промоутер ва H3-HA аз галактоза-индуксионалӣ ГАЛ1 мусоидаткунанда. (Б.) Штамми назорати YKY64 ба YKY69 монанд аст, ба истиснои он ки ду версияи барчаспшудаи H3 зери назорати худи HHT2 промоутер, ки дар натиҷа якҷоя ифодаи онҳост. (C) Ҳуҷайраҳои YKY69 дар аввал дар муҳити норасоии метионин ва дорои рафиноза парвариш карда мешаванд, ки ба ифодаи танҳо H3-VSVG ("гистони кӯҳна") оварда мерасонад. Метионин барои 4,5 соат илова карда мешавад MET3 промоутер ва қатъ кардани ифодаи H3-VSVG (намунаи А). Пас аз он ҳуҷайраҳо бо галактоза коркард карда мешаванд, то ифодаи H3-HA («гистони нав») дар тӯли 2,5 соат, 4,5 соат ва 6,5 соат (мутаносибан намунаҳои B, C ва D). Намунаи E аз ҳуҷайраҳои YKY69 иборат аст, ки дар тӯли 20 соат дар муҳити дорои ҳам метионин ва ҳам галактоза парвариш карда мешаванд, ки дар натиҷа H3-HA ифода карда мешаванд. (Д) Тартиби ичрои CHIP пайдарпайи мононуклеосомахо.

Штамми таҷрибавӣ дар аввал дар сурати набудани метионин парвариш карда шуд, то индуксия MET3 промоутер, ки дар натиҷа H3–VSVG-и кӯҳна ифода меёбад (расми 1C). Азбаски рафиноза ҳамчун манбаи карбон истифода мешуд ГАЛ1 промоутер танзимкунандаи H3-HA дар айни замон беэътибор монд. Барои пахш кардани MET3 промоутер ва қатъ кардани ифодаи H3-VSVG, метионин илова карда шуд ва ҳуҷайраҳо иҷозат доданд, ки дар тӯли 4,5 соат афзоиш ёбанд, ки тақрибан як насл буд. Баъди ин давраи MET3 репрессияи промотор, галактоза барои индуксия илова карда шуд ГАЛ1 промоутер ва ба ин васила синтези нави H3-HA-ро оғоз мекунад. Намунаҳо барои таҳлил пеш аз (назорати манфӣ) ва дар 2,5 соат, 4,5 соат ва 6,5 соат пас аз илова кардани галактоза гирифта шуданд. Ҳамчун назорати дигари манфӣ, ҳуҷайраҳои дар як шаб дар ҳузури метионин ва галактоза парваришшуда вазъиятеро нишон доданд, ки танҳо H3-HA-и нав ба вуҷуд меояд.

Таҷрибаи муҳим ин иҷрои пайдарпайи ChIP (25) дар мононуклеосомаҳои аз намунаҳои гуногун ҷудошуда буд. Махсусан, хроматини ба формальдегид пайвастшуда бо нуклеазаи микрококкӣ коркард карда шуд, то порчаҳои хроматинии андозаи мононуклеосомаро ба вуҷуд оваранд, ки онҳо ба ду марҳилаи иммунопреципитация барои ба даст овардани порчаҳои ДНК алоқаманд бо ҳам бо VSVG ва ҳам HA-тамғаи H3 алоқаманданд (расми 1)Д). Пас аз баргардонидани пайвандҳо, ДНКҳо аз иммунопреципиатсияҳо ва вурудоти якка ва пайдарпай дар як гел ҷудо карда шуданд ва порчаҳои ДНК-и андозаи мононуклеосома ҷудо ва тавассути PCR миқдорӣ таҳлил карда шуданд. Барои назорат кардани фарқиятҳо дар барқарорсозии намуна, ДНКҳо бо миқдори ками доимии ДНК-и плазми ғайрихамиртуруши ҳазмшуда омехта карда шуданд, то барои тоза кардани гел сигналҳои ПТР аз порчаи 148-bp тавлидшуда барои ба эътидол овардан истифода шуданд.

Таҷрибаҳои назоратӣ.

Мувофиқи тарҳи таҷрибавӣ, мо сатҳи ибтидоии баланди H3–VSVG-ро пеш аз индуксияи галактоза мушоҳида мекунем (расми 2).А, намунаи А), пас аз талафоти тадриҷан (намунаҳои B–E). Баръакс, сатҳи H3-HA нав дар аввал хеле паст аст (расми 2Б., намунаи A) ва дар тӯли вақт зиёд кунед (намунаҳои B–E). Талафоти зудтари H3-VSVG-и кӯҳна дар баъзе маҳалҳо бо ҳамроҳшавии босуръати H3-HA-и нав пурра карда мешавад ва ин аз суръати баландтари мубодилаи мустақили гистонҳо дар ORFs ва промоутерҳои фаъоли ген интизор аст (14-16) . Ин минтақаҳои динамикӣ бо қурби мубодилаи нуклеосомаҳои баланд дохил мешаванд PMA1(+337), дар минбаъда RPL3(+492). Мубодилаи хоксорона дар мушоҳида мешавад FLO1(-130), PHO5(+56), ва ASC1(+87). Сарфи назар аз ин фарқиятҳо дар сатҳи муттаҳидшавии H3-HA, маконҳои статикӣ (ТЕЛВИ-Р ва ПОЛ1) ассотсиатсияи назарраси 30%, 50% ва 75% сатҳҳои ниҳоӣ дар 2,5 соат, 4,5 соат ва 6,5 соатро нишон медиҳад. Ҳамин тариқ, ин курси вақти индуксия бояд имкон диҳад, ки тетрамерҳои омехтаи эҳтимолӣ дар маҳалҳои гуногун муайян карда шаванд. Дар штамми назорати мусбӣ, ки дар он H3–VSVG ва H3–HA аз промоутери аслии H3 якҷоя ифода карда мешаванд, ҳарду ҳосилаҳои барчаспшудаи H3 дар сатҳи баланд дохил карда мешаванд (расми 2). А ва Б., намунаи F).

Ассотсиатсияи H3 кӯҳна ва нав дар маҳалҳои гуногун. Ҳуҷайраҳои YKY69 барои ба вуҷуд овардани ифодаи "кӯҳна" H3-VSVG, пас аз он репрессия ва сипас тавассути индуксияи ифодаи "нав" H3-HA, тавре ки дар расми 1 тасвир шудааст, коркард карда шуданд.C. Дар намунаҳои A ва E, танҳо як шакли ягонаи H3 индуксия ва ба таври назаррас дохил карда шуд (мутаносибан VSVG- ва HA-тагрезӣ), дар ҳоле ки хроматини намунаҳои B-D дорои ҳарду шакли H3, ки дар вақтҳои гуногун дохил карда шудаанд. Намунаи F штамми назоратии YKY64-ро ифода мекунад, ки ду шакли барчаспшудаи H3-ро аз промоутери аслии худ якҷоя ифода мекунад. Графикҳо натиҷаҳои миёнаи таҳлили ChIP бо истифода аз VSVG (А) ё HA (Б.) антитело. Мавҷудияти H3 дар як макони теломерӣ таҳлил карда шуд (ТЕЛВИ-Р) ва шаш генҳои гуногун бо мавқеъҳо нисбат ба макони оғози тарҷума нишон дода шудаанд.

Умуман омехтаи ками H3-и кӯҳна ва нав дар як нуклеосома.

ChIP пайдарпай дар мононуклеосомаҳо барои муайян кардани ҳамбастагии нуклеосомаҳои H3-VSVG ва H3-HA дар локусҳои гуногуни геномӣ дар ҷараёни вақти индуксияи галактоза истифода мешуд (расми 3). Вақте ки аз промоутери аслии H3 (яъне, намунаи штамми назоратии мусбат F), ду ҳосилаҳои H3 қимматҳои баланди ҳамбастагӣ нишон медиҳанд, ки аз арзишҳое, ки ҳангоми индуксия танҳо як версияи H3 дида мешуданд (намунаҳои назорати A ва E) хеле зиёданд. Ин қобилияти мо барои муайян кардани мавҷудияти ду ҳосилаҳои H3 дар як нуклеосома (яъне тетрамери омехтаи H3-H4) дар диапазони назарраси динамикӣ тасдиқ мекунад. Намунаи E, ки дар он танҳо ГАЛ1 промоутер ба вуҷуд меояд, нисбат ба намунаи А сатҳи баландтари ҳамбастагӣ нишон медиҳад, аз сабаби ифодаи боқимондаи H3-VSVG аз репрессияшуда MET3 мусоидаткунанда. Ҳамин тариқ, арзишҳои ҳамбастагии намунаи E ҳамчун заминаи таҷрибавӣ гирифта шуданд ва танҳо арзишҳои хеле баландтар ҳамчун сигналҳои мусбӣ, ки дар натиҷаи ҳамбастагии H3-VSVG ва H3-HA ба вуҷуд омадаанд, гирифта шуданд.

Якҷоя будани нуклеосомаҳои H3 кӯҳна ва нав. Намунаҳо аз таҷрибаҳо дар расми тасвиршуда. 1C ва 2 бо истифода аз антителоҳои VSVG ва HA ду даври иммунопреципиатсия гузаронида шуданд. Графикҳо натиҷаҳои миёнаи таҳлили пайдарпайи ChIP-ро нисбат ба арзишҳои намунаи як-индуксионии E, ки заминаи таҷрибавӣ ҳисобида мешаванд, нишон медиҳанд. Ҷойгиршавии H3 дар як макони теломерӣ таҳлил карда шуд (ТЕЛВИ-Р) ва шаш генҳои гуногун бо мавқеъҳо нисбат ба макони оғози тарҷума нишон дода шудаанд.

Дар муқоиса бо ҳамбастагии баланди H3-VSVG ва H3-HA ҳангоми якҷояшавӣ, ҳамон сафедаҳои пайдарпай ҳамчун шаклҳои кӯҳна ва нави H3 ифодашуда сатҳи пасти ҳамҷоягиро нишон медиҳанд (намунаҳои B-D). Ҳамин тариқ, H3 кӯҳна ва нав, ки дар ҳафт макони гуногуни геномӣ санҷида шудаанд, аксар вақт дар як нуклеосома мавҷуд нестанд. Ин маълумотҳо нишон медиҳанд, ки аксари ҳодисаҳои ҳамроҳшавии H3 дар геноми хамиртуруш тақсимоти тетрамерро дар бар намегиранд.

Омезиши Димерҳои H3-H4 дар дохили минтақаҳои мубодилаи динамикӣ гистон.

Гарчанде ки сатҳи ҳамҷоя будани H3-и кӯҳна ва нав асосан дар заминаи таҷрибавӣ муайян карда намешавад, баъзе ҷойҳо арзишҳоеро нишон медиҳанд, ки ба таври равшан баландтаранд. Аз онҳо, арзишҳои баландтарин дар ба даст оварда шудаанд PMA1(+337) соати 2,5, 4,5 ва 6 (П-арзишҳо мутаносибан < 0,01, < 0,005 ва < 0,025, аз ҷониби Welch ҷудонашуда т-озмоиш), пас аз он RPL3(+492) дар 2,5 ва 4,5 соат (< 0,05 ва < 0,025) ва баъд PHO5(+56) дар 4,5 соат (< 0,025). Ҷолиб он аст, ки сатҳи ҳамбастагии локусҳои гуногун умуман бо қурби мубодилаи нуклеосомаҳои онҳо алоқаманд аст. Сатҳи баландтарини ҳамҷояӣ ҳангоми мубодилаи босуръат мушоҳида мешавад PMA1(+337) ҷойгир шуда, тақрибан ба 25% сатҳе, ки ҳангоми якҷоя ифода кардани шаклҳои гуногуни барчаспшудаи H3 мушоҳида мешавад (пас аз хориҷ кардани заминаи таҷрибавӣ) мерасад. Ҳамин тариқ, дар нуклеосомаҳои хеле динамикӣ сатҳи назарраси тақсимоти тетрамер ба амал меояд.

Аслан, андозагирии ҳамҷоя танҳо сатҳи тетрамерҳои омехтаи H3-H4 дар ҳар як минтақаи геномиро инъикос мекунанд. Ҳамин тавр, ҳамҷояӣ аз сатҳҳои нисбии ду ҳосилаҳои H3 дар як макони додашуда дар вақти муайян вобаста хоҳад буд, аммо он набояд аз суръати мубодилаи гистонҳо вобаста бошад. Барои як макони додашуда, ҳадди аксар ҳамбастагӣ бояд вақте ба амал ояд, ки ҳарду ҳосилаҳои H3 дар 50% аз сатҳи максималӣ мавҷуд бошанд ва ҳамҷояҳо тадриҷан коҳиш меёбанд, зеро сатҳҳои ассотсиатсияҳои ҳосилаҳои инфиродии H3 ихтилофи бештар доранд. Ҳамин тариқ, беҳтарин муқоисаи арзишҳои ҳамҷояӣ дар байни маҳалҳои гуногун ченакҳоро дар бар мегирад, ки дар он ассотсиатсияи нисбии ду ҳосилаҳои H3 шабеҳ аст, на ченакҳо дар як нуқтаи вақт. Масалан, ҳамбастагии равшан дар динамикӣ PMA1 локус дар 2,5 соат мушоҳида мешавад, вақте ки сатҳи нави H3–HA ба 83% ассотсиатсияи пурра мерасад. Аммо, дигар локусҳо, ки дар вақтҳои баъдӣ яксонии H3-HA нишон медиҳанд (масалан, ПОЛ1, ASC1, ва FLO1) дарачахои якхелаи кокулият надоранд. Умуман, дар ҳама локусҳо шароит барои санҷиши ҳамҷоягии максималӣ ба даст оварда шудааст, аммо ҳамҷоя танҳо дар генҳои фаъол мушоҳида мешавад (расми 3), ки суръати баланди мубодилаи H3-ро нишон медиҳанд (расми 2). Ҳамин тариқ, тақсимоти тетрамер асосан дар генҳои транскриптӣ фаъол рух медиҳад ва бо мубодилаи динамикии гистонҳо хуб алоқаманд аст.

Барои баррасии минбаъдаи робитаи байни қурби мубодилаи гистонҳо ва омезиши H3-и кӯҳна ва нав, мо ҳафт макони иловагиро дар генҳое, ки дар назар дошта мешаванд, таҳлил кардем.STL1 ва GRE2) ё баланд (TEF1, ENO2, ва PYK1) сатҳи ифода дар шароити таҷрибавии мо. Ин локусҳо бо қурби мубодилаи H3-и худ фарқ мекунанд, тавре ки бо ҳамроҳшавии нави H3-HA дар 2,5 соат нишон дода шудааст, бо STL1(+1297) ва GRE2(+682) камтар динамикӣ, тавре ки пешгӯӣ карда мешавад (расми 4А). Дар се ENO2 мавқеъҳои таҳлилшуда, сатҳи дохилшавии H3-HA бо наздикӣ ба макони ибтидоии ген мувофиқат мекунад. Чунон ки дар расми 4 нишон дода шудаастБ., ҳамбастагии H3-VSVG ва H3-HA дар 2,5 соат ва 4,5 соат индуксияи галактоза (намунаҳои B ва C) нисбат ба заминаи таҷрибавӣ (намунаи якиндуксионии E) мувофиқи афзоиши суръати H3-HA меафзояд. сатҳҳои дохилшавӣ (расми 4А). Ҳамин тариқ, дар сатҳи нисбатан статикӣ сатҳи наздики заминавӣ мушоҳида мешавад STL1(+1297), GRE2(+682), ва ENO2(STOP) loci, пас аз он сатҳҳои баландтар дар динамикӣ ENO2(+970), ва сатҳҳои ҳатто баландтар дар маконҳои динамиктарин TEF1(+68), ENO2(+88), ва PYK1(+245). Ин натиҷаҳо боз нишон медиҳанд, ки гарчанде ки тақсимшавии тетрамерҳо одатан як ҳодисаи камёб аст, он дар минтақаҳои мубодилаи нуклеосомаҳои баланд паҳн мешавад ва сатҳи назарраси тетрамерҳои омехтаи аз гистонҳои кӯҳна ва навро ба вуҷуд меорад.

Ҷойгиршавии нуклеосомӣ ва ҳамбастагии H3-и индуксионӣ дар локусҳои фаъол ва ғайрифаъол. Намунаҳои ягона ва пайдарпайи ChIP аз таҷрибаҳои анҷир. 1, 2 ва 3 барои ассотсиатсия дар маҳалҳои иловагӣ таҳлил карда шуданд. Графикҳо натиҷаҳои миёнаи (А) Таҳлили CHIP бо истифода аз антителоҳои HA, тавре ки дар расми 2 тасвир шудаастБ., ё (Б.) пайдарпайи ChIP бо истифода аз антителоҳои VSVG ва HA, тавре ки дар расми 3 тавсиф шудааст. Ҷойгиршавии H3 дар генҳои гуногун бо мавқеъҳо нисбат ба макони оғози тарҷума ё атрофи кодони қатъ таҳлил карда шуд (ИСТ) нишон дода шудааст.


Муҳокима

ROS дар пайдоиш ва эволютсияи аномалияҳои генетикӣ алоқаманд аст, аммо чанд таҳқиқот таъсири онҳоро ба сикли ҳуҷайра ва нуқтаҳои назорати ДНК баррасӣ кардаанд. Дар ин ҷо мо нишон медиҳем, ки дучоршавӣ ба консентратсияи пасти H2О2 пешравии сикли ҳуҷайраҳоро дар G ба таъхир меандозад1, С ва Г2 фазаҳо, аммо танҳо таъхир дар марҳилаи S аз ҷониби нуқтаҳои назорати ДНК назорат карда мешавад. Мувофиқи ин мушоҳида, мо дарёфтем, ки фосфоризатсияи Rad53 аз ҷониби H ба вуҷуд омадааст2О2 табобат махсусан дар марҳилаи S. Дар ниҳоят, мо нишон додем, ки набудани фосфоризатсияи Rad53 пас аз H2О2 табобат дар Г1 ва Г2 фазаҳо аз таъмири хомӯш тавассути роҳи BER-и осеби оксиди ДНК дар ин марҳилаҳо ба вуҷуд меоянд.

Стрессҳои оксидшавии сублеталӣ тавассути роҳҳои назорати ДНК эҳсос карда мешаванд

Стрессҳои оксиди зери марговар, ки аз консентратсияи пасти H2О2 тавассути роҳҳои гузаргоҳи ДНК дар хамиртуруш муайян карда мешаванд ва аксуламалҳои вобаста ба Rad53-ро бармеангезанд. Ин мушоҳидаҳо фаҳмиши моро дар бораи аксуламалҳои ҳуҷайра ба стресси оксидитивӣ ғанӣ мегардонанд ва метавонанд барои дигар системаҳо оқибатҳои муҳим дошта бошанд. Бемориҳои ирсии инсон телеангиэктазияи атаксия, камхунии Фанконӣ ва синдроми Блум, ки бо зиёдшавии бемории саратон тавсиф мешаванд, инчунин бо вайроншавии мубодилаи оксиген алоқаманданд (Ротман ва Шило, 1997 барои баррасии Cerutti, 1985). Ғайр аз он, намудҳои сершумори хатҳои ҳуҷайраҳои варамҳо нишон дода шудаанд, ки сатҳи баланди H2О2 (Сзатровски ва Натан, 1991). Эҳтимол аст, ки ҳолатҳои прооксидантӣ ё баланд шудани сатҳи фишори доимии оксидитивӣ, ки ба фаъолсозии доимии нуқтаи назоратӣ оварда мерасонанд, метавонанд як шакли мутобиқшавиро ба вуҷуд оранд ва ба фаъолияти ноқиси ин роҳҳо оварда расонанд, вокунишҳои ғайримуқаррариро ба таҳқирҳои генотоксикӣ ба вуҷуд оранд ва ба паҳншавии беназорати ҳуҷайра мусоидат кунанд.

Таъхирҳои пероксиди гидроген дар Г1 ва дар Г2 аз пунктхои назорати ДНК мустакиланд

Мо нишон додем, ки танҳо таъхир дар марҳилаи S аз сабаби консентратсияи пасти H2О2 ба Rad53 вобаста аст. Механизмхое, ки барои кашолкорй дар Г1 ва Г2 марҳилаҳои пас аз H2О2 табобат номаълум боқӣ мемонад, аммо онҳо метавонанд аз ҷониби аксуламалҳои ҳуҷайравӣ ба ҷуз ҳамлаҳои оксидшавӣ ба ДНК ба амал оянд. Якчанд агентҳои генотоксикӣ ба таъхир афтодани Г1. Вақте ки глюкоза ба ҳуҷайраҳое, ки дар манбаи камбизоати карбон афзоиш меёбанд, илова карда мешавад, андозаи муҳими ҳуҷайра барои Оғоз тавассути ҳавасмандкунии глюкозаи роҳи Ras/cAMP аз андозаи хурд ба андозаи калон барқарор карда мешавад, ки экспрессияи онро коҳиш медиҳад. CLN1 (Флик ва дигарон., 1998). Ба ҳамин монанд, зарбаи гармӣ боиси боздоштани муваққатии Оғоз тавассути коҳиш мегардад CLN1 ва CLN2 транскриптҳо (Ровли ва дигарон., 1993). Дар бораи фишори оксидитивӣ, а сод1Δ мутант (ба цитозолии Cu, Zn-супероксиди дисмутаза таъсир мерасонад) ба 100% О дучор мешавад2 ба таври доимй дастгир карда шуд, дар Г1 тавассути боздоштани CLN1 ва CLN2 транскрипт (Ли ва дигарон., 1996), аммо иштироки нуқтаҳои назорати ДНК дар ин ҷилавгирӣ таҳқиқ карда нашудааст. Механизми шабеҳ метавонад дар ҳуҷайраҳои навъи ваҳшӣ, ки бо H2О2 дар Г1. Аммо, роҳҳои танзимкунанда барои Г1 ва Г2-М таъхир дар ҳуҷайраҳои навъи ваҳшӣ, ки ба фишори оксидитивӣ дучор мешаванд, муайян карда мешаванд.

Табобати пероксиди гидроген фосфоризатсияи Rad53-ро махсусан дар марҳилаи S ба вуҷуд меорад

Индуксияи фосфоризатсияи Rad53 махсусан пас аз илова кардани H2О2 ба ҳуҷайраҳои марҳилаи S-ро метавон бо таъсири консентратсияи пасти H шарҳ дод2О2 оид ба фаъолияти рибонуклеотид-редуктаза (RNR) тавассути камшавии агентҳои коҳишдиҳанда. Аммо, фосфоризатсияи Rad53 дар марҳилаи S ҳангоми дучор шудан ба H2О2 шадидтар аст apn1Δ apn2Δ ҳуҷайраҳо нисбат ба ҳуҷайраҳои навъи ваҳшӣ, ки ин ба таври қатъӣ шаҳодат медиҳад, ки осеби ДНК аз ҷониби H2О2 дар ин марҳила. Ғайр аз он, мушоҳидае, ки фосфоризатсияи Rad53 дар ҳуҷайраҳои навъи ваҳшӣ бо H коркард шудааст.2О2 қисман аз Rad9 ва Rad17 вобаста аст, дар ҳоле ки фосфоризатсияи Rad53, ки дар натиҷаи ғайрифаъолшавии RNR ба вуҷуд омадааст, аз Rad9 ва Rad17 комилан мустақил аст (Pellicioli) ва дигарон., 1999 маълумоти нашрнашудаи мо) бо мавҷудияти осебҳои ДНК дар марҳилаи S мувофиқ аст. Якчанд фарзияҳо метавонанд индуксияи мушаххаси фосфоризатсияи Rad53-ро дар ин марҳила ҳисоб кунанд. Аввалан, ба ғайр аз индукси зарари ДНК, Ҳ2О2 табобат инчунин метавонад ба фаъолияти RNR таъсир расонад, норасоии dNTP-ро ба вуҷуд орад ва сигналро ба Rad53 тавлид кунад, ки метавонад сигнали заифро, ки тавассути коркарди осебҳои ДНК ба вуҷуд омадааст, ба таври синергетикӣ афзоиш диҳад. Фарзияи дуюм метавонад ин бошад, ки Ҳ2О2 дар марҳилаи S аз сабаби ҳассосияти дохилии ДНК-и репликатсия ё аз сабаби он ки репликатсияи ДНК осебҳои аввалияро ба сохторҳои ДНК табдил медиҳад (танаффусҳои ДНК, ДНК-и якқатор ё миёнаравҳои рекомбинатсионие, ки дар натиҷаи боздоштани мушаки репликатсия ба вуҷуд омадаанд) зарари бештар ё гуногунро дар марҳилаи S ба вуҷуд меорад. Сенсорҳои зарари ДНК (Фоиани ва дигарон., 1998). Сеюм, механизмҳое, ки қодиранд Ҳ2О2-зарари ДНК-и ба вуҷуд омада метавонад дар марҳилаи S амал кунад, аммо дар G1 ё Г2. Сафедаҳои такрории ДНК Pol2, Dpb11 ва Rfc5 ва сафедаи Tof1 ба назар мерасанд, ки ҳам блокҳои репликатсия ва ҳам зарари ДНК-ро махсусан ҳангоми синтези ДНК ҳис мекунанд (Араки). ва дигарон., 1995 Навас ва дигарон., 1995, 1996 Сугимото ва дигарон., 1996, 1997 Фосс, 2001) ва метавонад дар сигнализатсияи H иштирок кунад.2О2- осебҳои ДНК ба Rad53.

Зарарҳои ДНК, ки дар Г1 ва Г2 бо консентратсияи пасти пероксиди гидроген бо роҳи BER дар ҳуҷайраҳои навъи ваҳшӣ бесадо таъмир карда мешаванд ва танҳо вақте ки онҳо бо ин роҳ нопурра коркард мешаванд, фосфоризатсияи Rad53-ро ба вуҷуд меорад.

Ба наздикӣ дар хамиртуруш аз ҷониби Siede робитаи байни табобати осебҳои ДНК-и ултрабунафш ва фаъолсозии нуқтаҳои назорати ДНК нишон дода шудааст. ва дигарон. (1994) ва Неке ва дигарон. (1999), ки нишон дод, ки фаъолсозии ултрабунафши роҳи гузаргоҳи Rad53 дар G1 ба таври қатъӣ аз сафедаи NER Rad14 вобаста аст. Ба ҳамин монанд, лимфобластҳои XP-A (ба гомологи инсон таъсир мерасонанд RAD14) миқдори зиёди шуоъҳои ултрабунафшро нисбат ба ҳуҷайраҳои навъи ваҳшӣ талаб мекунанд, то ифодаи p53 ҳангоми ҷилавгирӣ аз такрори ДНК (Нелсон ва Кастан, 1994). Ин тадқиқотҳо нишон доданд, ки осеби ДНК, ки дар натиҷаи вояи ками шуоъҳои ултрабунафш ба вуҷуд омадаанд, худ аз худ сигнали кофӣ барои фаъолсозии нуқтаи назорати ДНК дар G1 ё вақте ки репликатсияи ДНК монеъ мешавад ва танҳо мавҷудияти комплексҳои NER ё пайдоиши миёнаравҳои ДНК аз коркарди онҳо аз осебҳои ибтидоии ДНК қодиранд роҳҳои назорати ДНК-ро фаъол созанд.

Баръакси зарари ДНК-и ултрабунафш, осеби ДНК дар натиҷаи консентратсияи пасти H2О2 дар Г1 ё Г2 қодиранд, ки нуқтаҳои назорати ДНК-ро танҳо вақте фаъол созанд, ки онҳо бо роҳи BER нопурра коркард карда шаванд. Дар ҳуҷайраҳои навъи ваҳшӣ, осеби ДНК, ки аз ҷониби H2О2 табобат дар Г1 ё Г2 бо роҳҳои вобаста ба Apn1/Apn2 хомӯшона таъмир карда мешаванд, ба он маъно, ки коркарди онҳо нуқтаҳои назорати ДНК-ро фаъол намекунад. Ҳамин тариқ, таъмири осеби ДНК ба таври мунтазам бо фаъолсозии нуқтаҳои назорати ДНК алоқаманд нест ва ба назар чунин менамояд, ки онро барои самаранокии дуруст талаб намекунад. Мо дарёфтем, ки осеби ДНК дар Г1 ҳуҷайраҳо бо 0,8 мм H2О2 вақте ки ҳуҷайраҳо баъдан ба марҳилаи S расиданд (Расми 4A ва C), ки онҳо нишон доданд, ки осебҳо дар G таъмир карда шуданд, онҳо натавонистанд фосфоризатсияи Rad53-ро оғоз кунанд1 ба дарачае, ки барои пунктхои назоратй дар мархилаи S сигнали кофй набошад.

Ҳамин тариқ, намудҳои гуногуни осеби ДНК ва системаҳои таъмири онҳоро метавон аз рӯи қобилияти онҳо барои фаъолсозии роҳҳои назорати ДНК дар сурати набудани репликатсияи ДНК тасниф кард. Коркарди NER, роҳи вобаста ба Rad14 осебҳои ДНК-и ултрабунафш ба осонӣ ошкор ва ба Rad53 сигнал дода мешавад, дар ҳоле ки коркарди H2О2Чунин ба назар мерасад, ки осебҳои аз ҷониби BER, Apn1 / Apn2 вобаста ба гузаргоҳҳои ДНК нодида гирифта мешаванд. Дар сурати набудани Apn1 ва Apn2, осебҳои ибтидоии оксидшавӣ тавассути гликозилазаҳо/АП-лиазаҳо ба маконҳои абасикӣ бо шикастани як ришта табдил меёбанд. Пас фосфоризатсияи Rad53-ро чӣ ба вуҷуд меорад? Субстратҳои Apn1/Apn2 метавонанд мустақиман тавассути сафедаҳои нуқтаи назоратӣ ҳис карда шаванд ё минбаъд тавассути роҳҳои алтернативӣ ба миёнаравҳо коркард карда шаванд, ки нуқтаҳои назорати ДНК-ро фаъол созанд (Расми 8). Геликазҳо ё нуклеазаҳо метавонанд дар коркарди алтернативии субстратҳои Apn1 / Apn2 ҷалб карда шаванд. Ҷолиб он аст, ки Сяо ва Чоу (1998) ба наздикӣ на танҳо нишон доданд, ки мутатсия дар генҳои NER RAD1, RAD2, RAD4 ва RAD10 ва дар гени BER APN1 дар робита ба куштан аз ҷониби метилметансулфонат (MMS) синергетикӣ доранд, аммо инчунин дар байни рад apn1Δ мутантҳое, ки ҳам дар роҳҳои NER ва ҳам BER таъсир мерасонанд, rad1Δ apn1Δ ва rad10Δ apn1Δ мутантҳои дукарата фенотипҳои беназирро бо суръати сусти афзоиш ва ҳассосияти иловагии синергистӣ ба MMS нишон медиҳанд. Ин мушоҳидаҳо ба нақшҳои иловагӣ барои комплекси Rad1-Rad10 дар роҳҳои таъмири ДНК ишора мекунанд, ки бо Apn1 алоқаманданд, вале аз фаъолияти NER фарқ мекунанд. Илова бар ин, нест кардани RAD1 бо нест кардани ко-ллатнок маълум гардид APN1 ва APN2 (M.Guillet ва S.Boiteux, муоширати шахсӣ), дар ҳоле ки сегона apn1Δ apn2Δ rad14Δ мутант ягон нуқсони афзоишро нишон намедиҳад. Ин мушоҳида инчунин аз он шаҳодат медиҳад, ки Rad1, эндонуклеаза, ки дар бисёр роҳҳои таъмир иштирок мекунад, метавонад як ферменти алтернативӣ барои табобати субстратҳои Apn1 / Apn2 ва эҳтимолан сигнали онҳо ба нуқтаҳои назорати ДНК бошад.

Дар маҷмӯъ, маълумоти мо консепсияи таъмири бесадо осеби ДНК-ро нишон медиҳанд ва ҳассосияти баланди ҳуҷайраҳои фазаи S-ро ба H нишон медиҳанд.2О2. Бо назардошти аҳамияти осеби оксиди ДНК дар ҳуҷайраҳои аэробӣ, муайян кардани шахсият ва фаъолияти сенсорҳои зарари оксиди ДНК дар хамиртуруш ва инчунин дар ҳуҷайраҳои ширхӯрон ҷолиб хоҳад буд.


Натиҷаҳо

Нобудкунии зуд ва пурраи Hus1 дар ҳуҷайраҳои аввалияи фарҳангӣ тавассути рекомбинатсияи Cre-миёнадор

Барои санҷидани таъсири шадид Хус1 талафот дар ҳуҷайраҳои парваришшудаи ибтидоӣ, мо системаи генетикиро барои ғайрифаъолкунии танзимшаванда таъсис додем Хус1 дар MEFs. Ин система ба аллели шартӣ асос ёфтааст, Hus1 flox , ки дар он экзонҳои 2 ва 3 бо маконҳои loxP фаро гирифта шудаанд, пайдарпаии шинохти рекомбиназаи кре (расми 1А). Тадқиқотҳои қаблӣ нишон доданд, ки рекомбинатсияи cre-миёнаравӣ дар Hus1 flox экзонҳои 2 ва 3-ро нест карда, аллели нулро ба вуҷуд меорад, Хус1 Δ 2,3 , ки қобилияти рамзгузории 19-и аввали 281 аминокислотаҳои Hus1 (Левитт) дорад. ва дигарон., 2005). Барои шартӣ Хус1 ғайрифаъолкунӣ, мо тавлид MEFs дорои Hus1 flox ва ё Хус1 Δ 1 , аллели нулҳои конститутсионӣ, ки дар он экзон 1 ва кодони ибтидоӣ нест карда шудаанд (Вейс) ва дигарон., 2000) ё навъи ваҳшӣ Хус1 ҳамчун назорат ва сипас сироятҳоро бо Ad-cre анҷом дод. Дар хар ду Hus1 flox/+ ва Hus1 flox /Δ 1 MEFs, рекомбинатсияи миёнаравӣ пешбинӣ шуда буд, ки аллели шартиро ба аллели нул табдил диҳад Хус1 Δ2,3 . Ad-cre - сироятшуда Хус1 flox/+ ҳуҷайраҳо ифодаро идома медиҳанд Хус1 аз аллели боқимондаи ваҳшӣ, дар ҳоле ки Ad-cre-сироятшуда Хус1 flox/Δ1 ҳуҷайраҳо ягон функсионалӣ тавлид намекунанд Хус1 транскриптхо (расми 1А).

Расми 1. ғайрифаъолкунии шартии Хус1 дар MEF-ҳои ибтидоӣ бо истифода аз Ad-cre. $A) Нақшаи система барои ғайрифаъолкунии шартии Хус1. Гуногун Хус1 аллелҳои истифодашуда бо якчанд экзонҳои аввал нишон дода шудаанд. Хус1 flox шартӣ аст Хус1 аллеле, ки дар он экзонҳои 2 ва 3 бо маконҳои loxP (секунҷаҳои сиёҳ) паҳлӯ мешаванд. Пас аз сирояти Ad-cre, экзонҳои 2 ва 3 аз Hus1 flox аллел нест карда шуда, аллели нулро ба вуҷуд меорад Хус1 Δ2,3 . Як ғайрифаъол Хус1 транскрипт, ки экзонҳои 2 ва 3 надоранд, аз он истеҳсол карда мешавад Хус1 Δ 2,3 ва бо хати нуқта тасвир шудааст. Хус1 Δ 1 аллели таркибии нул мебошад, ки экзони 1 ва пайдарпаии иловагии болообиро надорад. Ad-cre - сироятшуда Хус1 flox/+ MEFҳо ба ифодаи ваҳшӣ идома медиҳанд Хус1 аз Хус1 + , дар ҳоле ки Ad-cre сироят шудааст Хус1 flox/Δ1 MEFҳо ягон функсионалӣ тавлид намекунанд Хус1 транскриптхо. $B) Таҳлили ҷанубии доғ Хус1 нест кардан пас аз сирояти Ad-cre. ДНК-и геномӣ аз он омода карда шуд Hus1 flox /+ ва Хус1 flox/Δ1 MEFs дар 1, 2, 3 ё 4 рӯз пас аз сироят бо Ad-cre ё дар 2 рӯз пас аз сирояти қалбакӣ (U, сироятнашуда) ва сипас ба таҳлили blot Southern гузаронида мешаванд. Ҳуҷайраҳое, ки дар ин таҷриба истифода шудаанд, пас аз Ad-cre ё сирояти масхаравӣ гузаштанд Hus1 flox , Хус1 +, ва Хус1 Δ 2,3 бандҳо нишон дода шудаанд. Дар Хус1 Δ 1 аллел дар ин таҳлил муайян карда нашудааст. (C) Таҳлили блоки шимолии mRNA, ки аз ҳуҷайраҳои Ad-cre ё бо тақаллуб сироятшуда омода карда шудааст Hus1 flox/+ ва Hus1 flox/ Δ1 MEFs. Мавқеъҳои стенограммаҳое, ки аз Hus1 flox , Хус1 +, ва Хус1 Δ 2,3 нишон дода шудаанд.

Дар аввал, вояи ҳадди ақали Ad-cre барои пурра нест кардани Hus1 flox аллел муайян карда шуд, ки заҳролудшавии ҳуҷайраҳои аз ҷониби cre (Loonstra ва дигарон., 2001 Силвер ва Ливингстон, 2001). Hus1 flox / + ҳуҷайраҳо бо вояи гуногуни Ad-cre сироят карда шуданд ва ДНК-и геномӣ дар 2 dpi ҷудо карда шуд ва ба таҳлили blot Southern гузаронида шуд. Пас аз муайян кардани вояи ҳадди ақали самараноки Ad-cre (маълумот нишон дода нашудааст), кинетикаи Хус1 бефаъолиятй санчида шуданд. То 1 рӯз пас аз сироят бо вояи ҳадди ақали Ad-cre, Hus1 flox аллели пурра ба он табдил ёфт Хус1 Δ 2,3 дар ҳарду Hus1 flox/+ ва Hus1 flox/ Δ1 MEFs (Расми 1B). Барои арзёбӣ таҳлили blot Northern низ гузаронида шуд Хус1 ифода дар вақтҳои мувофиқ пас аз сирояти Ad-cre. Тавре ки дар расми 1C нишон дода шудааст, масхара сироят шудааст Hus1 flox /+ ва Хус1 flox/Δ1 ҳуҷайраҳои ҳарду намуди ваҳшӣ ифода карда шудаанд Хус1 транскриптҳо, бо сатҳи ифодаи баландтар дар Hus1 flox /+ ҳуҷайраҳо аз Hus1 flox/ Δ1 ҳуҷайраҳо тавре ки интизор мерафтанд. Ба зудӣ то 1 dpi, навъи ваҳшӣ Хус1 транскриптҳо дар Ad-cre-сироятшуда дигар ошкор карда намешаванд Hus1 flox/ Δ1 ҳуҷайраҳо ва бо мРНК-и молекулярии пасттар, ки ба ғайрифунксионалӣ мувофиқ аст, иваз карда шуданд Хус1 Δ 2,3 транскрипт. Ad-cre - сироятшуда Hus1 flox /+ ҳуҷайраҳои ҳарду намуди ваҳшӣ ифода карданд Хус1 ва Хус1 Δ 2,3 транскриптҳо тавре ки интизор мерафт. Хулоса, ин натиҷаҳо нишон медиҳанд, ки сирояти Ad-cre аз MEF-ҳои шартии нокаутӣ имкон медиҳад, ки зуд ва самаранок ғайрифаъол карда шаванд. Хус1.

Hus1 талафоти натиҷаҳо дар коҳиши паҳншавии ҳуҷайраҳо ва афзоиши апоптоз

Фибробластҳо аз Хус1-ҷанинҳои нокифоя дар фарҳанг паҳн намешаванд (Вейс ва дигарон., 2000). Аммо, ин таҷрибаҳо аз он сабаб мураккабанд, ки Хус1-ҳуҷайраҳои нул бояд аз ҷанинҳои аз ҷиҳати морфологӣ ғайримуқаррарӣ дар марҳилаи хеле пештари рушд нисбат ба фарҳанги MEF хос ба даст оварда шаванд. Шартӣ Хус1 системаи нокаут имконият дод, ки зуд ғайрифаъол шавад Хус1 дар шумораи зиёди MEFs муқаррарӣ ва барои санҷиши таъсири фаврии Хус1 норасоӣ дар муҳити назоратшаванда. Барои тафтиш кардани таъсири Хус1 талафот дар паҳншавии ҳуҷайраҳо, мо аввал PDL-ро барои сироятёфтагон ва Ad-cre-ро ҳисоб кардем. Hus1 flox /+ ва Hus1 flox/ Δ1 MEFs аз рӯи ҷадвали анъанавии гузариш 3T3 парвариш карда мешаванд. Тавре ки дар расми 2А нишон дода шудааст, MEF-ҳои ҳамаи генотипҳо дар аввал ба ҳамин монанд дучанд шуданд. Аммо, пас аз 4 dpi Ad-cre-сироятшуда Hus1 flox/ Δ1 MEFs нисбат ба назорати Ad-cre аз сироятёфта PDL-ҳои хеле камтар ҷамъоварӣ карданд Hus1 flox /+ MEFs ё масхара сироятшуда Hus1 flox/ Δ1 MEFs. Ин натиҷаҳо нақши муҳимро барои муайян мекунанд Хус1 дар дучандшавии ҳуҷайра дар шароити муқаррарии афзоиш.

Расми 2. ғайрифаъолкунии шартии Хус1 боиси вайрон шудани паҳншавии ҳуҷайраҳо ва афзоиши апоптоз мегардад. $A) Таҳлили паҳншавии ҳуҷайраҳо. Hus1 flox /+ ва Хус1 flox/Δ1 MEF-ҳо дар гузаргоҳи якум бо Ad-cre сироят ёфтаанд ё бо тамасхур сироят ёфтаанд ва сипас мувофиқи ҷадвали фарҳанги 3T3, тавре ки дар мақола тавсиф шудааст, парвариш карда мешаванд. Мавод ва усул. Сюжет шумораи PDL-ҳои ҷамъшударо нишон медиҳад. (B) Намоиши схематикии қитъаи нуқтаи FACS тақсимоти давраи ҳуҷайра. Шиддатнокии рангкунӣ барои PI (х-меҳвар) дар муқоиса бо он барои зидди BrdU-FITC (y- меҳвар). Аҳолии марҳилаи S ба S1 (BrdU мусбат) ва S2 (BrdU манфӣ) тақсим карда мешавад. $C) Таъсири Хус1 талафот дар тақсимоти давраи ҳуҷайра. MEF-ҳои генотипҳои зикршуда бо BrdU дар вақтҳои нишондодашуда пас аз сироят ё сирояти қалбакӣ нишон дода шуда, бо анти-BrdU ва PI ранг карда шуда, бо цитометрияи ҷараён таҳлил карда шуданд. Ҳуҷайраҳо 1 д пеш аз тамғагузории BrdU гузаштанд. Фоизи ҳуҷайраҳо дар ҳар як марҳилаи давраи ҳуҷайра нишон дода шудааст. (D ва E) Афзоиши апоптоз пас аз ғайрифаъолкунии шартии Хус1. MEF-ҳои генотипҳои зикршуда бо Annexin V-FITC ва PI дар вақтҳои нишондодашуда пас аз сироят ё сирояти қалбакӣ ранг карда шуданд ва тавассути цитометрияи ҷараён таҳлил карда шуданд. (D) Дар график фоизи ҳуҷайраҳои апоптозӣ нишон дода шудааст (Замимаи V мусбат, PI манфӣ). Арзишҳо миёнаи се таҷрибаҳои мустақил бо сатрҳои хатогӣ SD-ро ифода мекунанд. (E) Намояндаи нуқтаҳои FACS, ки апоптозро дар ҳуҷайраҳои генотипҳои зикршуда дар 7 рӯзи пас аз сироят ё сирояти қалбакӣ нишон медиҳанд. Шиддатнокии рангкунӣ барои PI (х-меҳвар) дар муқоиса бо он барои Annexin V-FITC (y- меҳвар). Фоизи ҳуҷайраҳое, ки ҳамчун апоптотикӣ (квадранти болоии чапи Анексин V мусбат, PI манфӣ) ё некротикӣ (квадранти болои рости Анексин V мусбат, PI мусбат) гурӯҳбандӣ шудаанд, нишон дода шудааст.

Ҳуҷайраҳои камшуда дучанд мешавад Хус1 ҳуҷайраҳои шартии нокаут метавонанд аз боздошти давраи ҳуҷайра, апоптоз ё ҳарду бошанд. Барои фарқ кардани ин имкониятҳо, мо аввал пешрафти онро назорат кардем Hus1 flox /+ ва Хус1 flox/Δ1 MEFs тавассути давраи ҳуҷайра пас аз сирояти Ad-cre. Фарҳангҳои асинхронӣ пас аз тамғагузорӣ бо BrdU дар 2, 4 ё 6 dpi ҷамъоварӣ карда шуданд. Таҳлили тақсимоти давраи ҳуҷайраҳо аз ҷониби FACS дуҷониба фарқияти назаррасро байни ҳуҷайраҳои гуногун ошкор накардааст. Хус1 генотипҳо дар 2 dpi (Расми 2, B ва C). Бо вуҷуди ин, дар ҳам 4 ва 6 dpi шумораи ками ҳуҷайраҳо, ки дорои мундариҷаи ДНК-и фазаи S буданд, вале BrdU манфӣ буданд (S2 таъин карда шудаанд) махсусан дар Ad-cre-сироятшуда пайваста мушоҳида карда шуданд. Хус1 flox/Δ1 фарҳангҳо (5,38% дар 4 dpi ва 4,61% дар 6 dpi). Ин ҳуҷайраҳои ғайримуқаррарии S-фаза дар назорати Ad-cre-сироятшуда кам буданд Хус1 flox/+ фарҳангҳо (1,40% дар 4 dpi ва 1,50% дар 6 dpi), инчунин фарҳангҳои сироятнашуда. Тақсимоти ҳуҷайраҳо дар марҳилаҳои дигари сикли ҳуҷайра асосан бетаъсир набуд Хус1 талафот Андозаи ҷамъшавии Ad-cre-сироятшуда Хус1 flox/Δ1 MEFs дар Г2/М кайд карда шуд, вале барои Ad-cre-инфекционй натицахо мушохида карда шуданд Hus1 flox /+ MEFs.

Саҳми апоптоз ба коҳиши дучандшавии шартӣ Хус1 ҳуҷайраҳои нокаут низ тафтиш карда шуданд.Апоптоз тавассути таҳлили цитометрии ҷараёни ҳуҷайраҳои бо Анексин V, протеини ҳатмии фосфолипид, ки метавонад барои муайян кардани ҳуҷайраҳое истифода шавад, ки дар он фосфатидилсерин аз варақаи дарунӣ ба варақаи берунии мембранаи плазма, аломати апоптоз (Вермес) кӯчонида шудааст, чен карда шуд. ва дигарон., 1995). Ҳуҷайраҳо инчунин бо PI ҳамчун ченаки якпорчагии мембрана ранг карда шуданд, то ҳуҷайраҳои солим дар марҳилаҳои ибтидоии апоптоз аз ҳуҷайраҳои гирифтори некроз ё дигар шаклҳои марги ҳуҷайра фарқ кунанд. Фоизи ҳуҷайраҳо дар марҳилаҳои аввали апоптоз (Annexin V + PI -) дар шартӣ Хус1 фарҳангҳои нокаут ва назорат дар расми 2D нишон дода шудааст. Зиёда аз 4 dpi, Ad-cre сироятшуда Хус1 flox/Δ1 фарҳангҳо нисбат ба Ad-cre сироятшуда пайваста фоизи бештари ҳуҷайраҳои апоптозиро дар бар мегиранд Hus1 flox /+ ва масхара сироят кардааст Хус1 flox/Δ1 фарҳангҳо, гарчанде ки ин фарқиятҳо аз ҷиҳати оморӣ муҳим набуданд. Масалан, дар 7 dpi 12,3 ± 2,5% аз Ad-cre сироятшуда Хус1 flox/Δ1 ҳуҷайраҳо апоптоз буданд, дар муқоиса бо 9,0 ± 2,1% аз Ad-cre сироятшуда Hus1 flox /+ ҳуҷайраҳо ё 9,5 ± 1,1% аз сироятёфтагон Хус1 flox/Δ1 ҳуҷайраҳо. Қитъаҳои намояндагӣ, ки таҳлили FACS-и апоптозро дар шартӣ нишон медиҳанд Хус1 фарҳангҳои нокаут дар расми 2E оварда шудаанд. Якҷоя, натиҷаҳо нишон медиҳанд, ки Хус1 ғайрифаъолкунӣ боиси коҳиши дучандшавии ҳуҷайраҳо тавассути тағироти нозуки давраи ҳуҷайра ва афзоиши апоптоз мегардад.

Норасоиҳои стихиявии хромосома пас аз ғайрифаъолкунии шартии Hus1

Hus1 дар роҳе амал мекунад, ки барои нигоҳ доштани тамомияти геномӣ муҳим аст. Барои муайян кардани андозаи зарари геномӣ дар шарт Хус1 ҳуҷайраҳои нокаут, мо басомади нуқсонҳои умумии хромосомаро дар паҳншавии метафаза муайян кардем, ки аз Ad-cre сироятшуда омода шудааст. Hus1 flox /+ ва Хус1 flox/Δ1 MEFs. Ad-cre - сироятшуда Хус1 flox/Δ1 ҳуҷайраҳо афзоиши назарраси нуқсонҳои хромосомаро нишон доданд, ки аввал дар 5 dpi ошкор карда мешуд (Ҷадвали 1). То ин вақт, 55% шартӣ Хус1 Ҳуҷайраҳои нокаутӣ ҳадди аққал як нуқсон доштанд ва 45% зиёда аз ду нуқсонҳо доштанд, аз ҷумла якчанд ҳуҷайраҳо бо чунин осеби геномӣ, ки онро ҳисоб кардан ғайриимкон аст. Баръакс, танҳо 11,8% -и назорати Ad-cre сироят ёфтааст Hus1 flox /+ MEFs дорои нуқсонҳои хромосомӣ дар 5 dpi буданд ва ҳеҷ кадоме аз ду нуқсонҳо зиёд набуданд. Танаффусҳои хромосомаҳо ва холигоҳҳое, ки ба як хроматид таъсир мерасонанд, аз ҳама маъмултарин нуқсонҳои шартӣ буданд Хус1 ҳуҷайраҳои нокаут (Расми 3А ва Ҷадвали 1). Мубодилаи хроматидҳо инчунин дар басомади паст мушоҳида карда шуданд.

Ҷадвали 1. ғайрифаъолкунии шартии Хус1 боиси афзоиши нуқсонҳои хромосомӣ мегардад

аз ҳуҷайраҳои генотипҳои зикршуда хромосомаҳои метафаза омода карда шуданд ва пайдоиши нуқсонҳои хромосомӣ миқдори муайян карда шуд.

б Рӯзҳои пас аз сирояти Ad-cre.

в Зарари васеъ ба метафазаҳое дахл дорад, ки дорои нуқсонҳои аз ҳад зиёди хромосомаҳо барои ҳисоб кардан лозим аст.

Расми 3. Шартӣ Хус1 ғайрифаъолкунӣ боиси нуқсонҳои хромосомӣ ва фосфоризатсияи H2AX дар MEF-ҳои ибтидоӣ мегардад. $A) Афзоиши нуқсонҳои умумии хромосомӣ дар Хус1 ҳуҷайраҳои шартии нокаут. Пахншавии метафаза аз Hus1 flox /+ ва Хус1 flox/Δ1 MEFs дар 1, 3 ва 5 рӯз пас аз сирояти Ad-cre ё дар 2 рӯз пас аз сирояти қалбакӣ (U, сироятнашуда). Ҳуҷайраҳои дар 3 ё 5 dpi таҳлилшуда 2 рӯз пеш аз омода кардани паҳншавии метафаза гузаронида шуданд. Тасвирҳои намояндагӣ бо сарҳои тирчаҳо нишон дода шудаанд, ки нуқсонҳои хромосомаиро нишон медиҳанд. (B ва C) Ҷамъоварии γ-H2AX дар Хус1 ҳуҷайраҳои шартии нокаут. (B) Фоизи ҳуҷайраҳои γ-H2AX-мусбат тавассути таҳлили ғайримустақими иммунофлуоресцентӣ муайян карда шуд. Арзишҳо шумораи миёнаи ҳуҷайраҳо бо шумораи нишондодашудаи фокусҳои γ-H2AX аз се майдони мустақили микроскопи 40 × бо сатрҳои хатогӣ SD мебошанд. (C) Тақсимоти давраи ҳуҷайраҳои ҳуҷайраҳои γ-H2AX-мусбат тавассути таҳлили FACS муайян карда шуд. MEF-ҳои генотипҳои нишондодашуда бо антителоҳои зидди γ-H2AX ва PI дар 4 ё 7 рӯз пас аз сирояти Ad-cre ё сирояти қалбакӣ ранг карда шуданд ва тавассути цитометрияи ҷараён таҳлил карда шуданд. Фоизи ҳуҷайраҳои γ-H2AX-мусбат дар марҳилаи S нишон дода шудааст.

Барои тавсифи минбаъдаи зарари стихиявии геном, ки пас аз танзим ба амал меояд Хус1 ғайрифаъолкунӣ, мо санҷишҳои иммунофлуоресцентиро барои муайян кардани γ-H2AX, шакли фосфоризатсияшудаи гистони H2AX, ки дар DSBҳо ҷамъ мешаванд, анҷом додем. Гарчанде ки фосфоризатсияи H2AX сигнали гузаргоҳро талаб мекунад, таҳқиқоти қаблӣ нишон доданд, ки Hus1 пас аз фишори такрорӣ барои ҷамъшавии γ-H2AX ҷудошаванда аст (Уорд ва Чен, 2001). Тавре ки дар расми 3B нишон дода шудааст, каме баланд шудани рангкунӣ барои γ-H2AX дар Хус1 flox/Δ1 ҳуҷайраҳо дар 4 рӯз пас аз сирояти Ad-cre ва 7 dpi 16,9 ± 3,9% аз Ad-cre сироятшуда Хус1 flox/Δ1 ҳуҷайраҳо дорои фокусҳои >10 γ-H2AX-мусбат будаанд, дар муқоиса бо ҳамагӣ 3,1 ± 3,4% аз Ad-cre сироятёфта Hus1 flox /+ MEFs. Калбакӣ сироятшуда Hus1 flox /+ ва Хус1 flox/Δ1 ҳуҷайраҳо сатҳи пасти рангкунии γ-H2AX-ро нишон доданд, ки шабеҳи он барои сироятёфтаи Ad-Cre мушоҳида шудааст. Hus1 flox /+ ҳуҷайраҳо (маълумот нишон дода нашудааст). Ҳамин тариқ, Хус1 талафот махсусан ба афзоиши фосфоризатсияи H2AX ва пайдоиши нуқсонҳои хромосомӣ оварда мерасонад. Мо баъдан таҳқиқ кардем, ки оё ин осебҳои ДНК дар марҳилаи мушаххаси сикли ҳуҷайра ба вуҷуд омадаанд. Ин тавассути таҳлили дуҷонибаи FACS аз сироятёфтагон ва Ad-cre анҷом дода шуд. Hus1 flox /+ ва Хус1 flox/Δ1 ҳуҷайраҳо пас аз ранг кардан бо антитело анти-γ-H2AX ва PI. Натиҷаҳо тасдиқ карданд, ки фосфоризатсияи H2AX дар сироятёфтаи Ad-cre Хус1 flox/Δ1 ҳуҷайраҳо ва минбаъд нишон дод, ки ҷамъшавии γ-H2AX пас аз Хус1 талафот асосан бо ҳуҷайраҳои дорои мазмуни ДНК-и S-фаза маҳдуд карда шуд (Тасвири 3C). Муҳим он аст, ки ин бозёфт аз сабаби нотавон будани ин усул барои муайян кардани γ-H2AX дар дигар марҳилаҳои давраи ҳуҷайра набуд, зеро дар G рангкунии мусбӣ мушоҳида шудааст.1, С ва Г.2Популяцияҳои / M пас аз коркарди ҳуҷайраҳо бо генотоксинҳои экзогенӣ (маълумотҳо Марти нишон дода нашудаанд ва дигарон., 2006). Дар маҷмӯъ, ин натиҷаҳо шартӣ будани онро нишон медиҳанд Хус1 ғайрифаъолкунӣ боиси афзоиши ноустувории геномӣ ва ҷамъшавии DSB дар марҳилаи S-и сикли ҳуҷайра мегардад.

Афзоиши ифодаи умумии сайти нозук пас аз ғайрифаъолкунии Hus1

Зарарҳои стихиявии ДНК дар шартӣ Хус1 ҳуҷайраҳои нокаут метавонанд ба таври тасодуфӣ дар тамоми геном ё дар минтақаҳои мушаххаси геномӣ пайдо шаванд. Азбаски Hus1 барои вазифаи нуқтаи назоратии S-фаза зарур аст ва инчунин барои вокунишҳои ҳуҷайра ба фишорҳои такрории беруна муҳим аст (Вейс ва дигарон., 2000, 2003), мо озмоиш кардем, ки хромосомаи стихиявӣ шикаста мешавад ё не Хус1-ҳуҷайраҳои нокифоя бештар дар CFS, минтақаҳои геномӣ дар шароити фишори репликатсия ба шикастан майл доранд (Гловер) ва дигарон., 2005). Бо ин мақсад, санҷишҳои FISH барои муайян кардани миқдори танаффусҳои хромосомӣ дар CFS дар шароити шартӣ гузаронида шуданд. Хус1 ҳуҷайраҳои нокаут. CFS бо истифода аз зондҳое, ки аз хромосомаҳои сунъии бактериявӣ, ки пайдарпаии геномии муш аз сайтҳои осебпазири Fra8E1 ва Fra6C1 омода карда шудаанд, муайян карда шуданд. Мутобиқи натиҷаҳое, ки дар расми 3А ва Ҷадвали 1 оварда шудаанд, Ad-cre-сироятшуда Хус1 flox/Δ1 ҳуҷайраҳо ба ҳисоби миёна 1,60-2,30 танаффус дар як ҳуҷайра нишон доданд, дар ҳоле ки Ad-cre сироятшуда Hus1 flox /+ ҳуҷайраҳо ба ҳисоби миёна танҳо 0,18-0,21 танаффусҳои хромосомаро дар як ҳуҷайра нишон доданд (Ҷадвали 2). Қобили зикр аст, ки афзоиши назарраси басомади шикастани стихиявии CFS дар шартан мушоҳида карда шуд Хус1 ҳуҷайраҳои нокаут. Дар CFS Fra8E1, нӯҳ танаффус дар байни 233 макони таҳлилшуда дар Ad-cre-инфексия муайян карда шуд. Хус1 flox/Δ1 ҳуҷайраҳо, дар муқоиса бо набудани танаффус дар 264 локали таҳлилшуда дар назорати Ad-cre-сироятшуда Hus1 flox /+ ҳуҷайраҳо. Тақрибан 10% (9 аз 91) танаффусҳо ва холигоҳҳои стихиявӣ дар Хус1-ҳуҷайраҳои нокифоя, ки дар ин макони нозук ҷойгир шудаанд. Ба ҳамин монанд, панҷ танаффус дар байни 151 макони CFS Fra6C1, ки дар Ad-cre сироятшуда таҳлил карда шудаанд, муайян карда шуданд. Хус1 flox/Δ1 ҳуҷайраҳо, ки 5,7% танаффусҳои мушоҳидашударо ташкил медиҳанд (5 аз 87), аммо ҳеҷ кадоме дар Ad-cre-сироятшуда ошкор карда нашудааст Hus1 flox /+ ҳуҷайраҳо. Тасвирҳои намояндагии FISH дар расми 4 нишон дода шудаанд. Ин натиҷаҳо нишон медиҳанд, ки танаффусҳои стихиявӣ, ки дар натиҷаи он ба вуҷуд меоянд Хус1 талафот бартарӣ дар CFSs рух медиҳад, таъсиси нақши нав барои Хус1 дар нигоҳдории устувории CFS.

Ҷадвали 2. ғайрифаъолкунии шартии Хус1 боиси зиёд шудани ифодаи макони нозук мегардад

як FISH барои муайян кардани макони CFS Fra8E1 ё Fra6C1, тавре ки дар тавсиф шудааст, истифода шудааст Мавод ва усул.

b Ҳуҷайраҳои инфиродӣ аз сабаби гум шудани хромосома ё полиплоидӣ баъзан аз чор сигнали FISH камтар ё бештар аз он иборат буданд, аз ин рӯ, шумораи умумии локусҳои CFS таҳлилшуда аз шумораи ҳуҷайраҳои таҳлилшуда 4 маротиба зиёд набуд.

Тасвири 4. Афзоиши ифодаи сайтҳои осебпазир пас аз Хус1 ғайрифаъолшавӣ. Тасвирҳои намояндагии ифодаи CFS дар паҳншавии метафаза, ки аз Ad-cre-сироятшуда омода карда шудаанд Хус1 flox/Δ1 MEFs. Ҳуҷайраҳо дар 2 dpi гузаштанд, барои омодасозии паҳншавии метафаза дар 4dpi ҷамъоварӣ карда шуданд ва сипас бо зондҳои хоси CFS Fra8E1 (A) ё Fra6C1 (B) (сабз) ранг карда шуданд ва бо DAPI (кабуд) ранг карда шуданд. Тасвирҳои якҷояшудаи рангкунии CFS ва DAPI (боло) ё тасвирҳои мувофиқ бо рангкунии танҳо DAPI (поён) нишон дода шудаанд. Тирчаҳо CFS-ро дар маконҳои солимии хромосомаҳо нишон медиҳанд ва сарлавҳаҳои тирчаҳо колокализатсияи CFS ва танаффусҳо ё холигии хромосомиро нишон медиҳанд.

P53 Пас аз ғайрифаъолкунии шартии Hus1 ҷамъ мешавад, аммо паҳншавии вайроншуда ва фенотипҳои афзояндаи апоптоз дар набудани он боқӣ мемонад

Мушоҳидаи зиёдшавии нуқсонҳои стихиявии хромосомӣ пас аз танзимшаванда Хус1 ҳазф эҳтимолияти коҳиши паҳншавии ҳамроҳшаванда ва афзоиши апоптоз метавонад аз сабаби аксуламали новобаста аз осеби ДНК аз Hus1 бошад. Мо қаблан хабар дода будем, ки p53 фаъол мешавад Хус1-ҷанинҳои бенуқсон, боиси афзоиши ифодаи генҳои ҳадафи p53 (Weiss ва дигарон., 2002) ва илова бар ин саҳ21 ё саҳ53 ғайрифаъолкунӣ имкон медиҳад, ки фарҳанги силсилавии Хус1- норасоии MEFs (Weiss ва дигарон., 2000 маълумоти нашрнашудаи мо). Бинобар ин, мо ин шартро фарзия кардем Хус1 ғайрифаъолкунӣ фаъолсозии p53 ва посухҳои минбаъдаи нуқтаи назоратро ба вуҷуд меорад. Азбаски фаъолсозии p53 бо эътидол ва ҷамъшавии сафедаи p53 алоқаманд аст (Харрис ва Левин, 2005), мо аввал сатҳи p53-ро дар сатҳи як ҳуҷайра тавассути таҳлили иммунофлуоресцентӣ чен кардем. p53 одатан дар ҳуҷайраҳои навъи ваҳшӣ дар сатҳи хеле паст аст, мувофиқан <3% аз Ad-cre-сироятшуда Hus1 flox /+ ҳуҷайраҳо дар 4, 7 ё 10 dpi p53 мусбат буданд. Баръакс, 12,7 ± 5,8 ва 14,3 ± 1,4% Хус1 flox/Δ1 ҳуҷайраҳо дар 7 ва 10 рӯзи сирояти пас аз Ad-cre, мутаносибан p53 мусбат буданд (Расми 5А). Мо чунин хулоса мебарорем, ки шартй Хус1 ғайрифаъолкунӣ боиси ҷамъшавии p53 мегардад.

Расми 5. p53 пас аз шартӣ ҷамъ мешавад Хус1 ғайрифаъолкунӣ, аммо нест кардани он наметавонад дучандшавии ҳуҷайраҳои вайроншуда ё зиёдшавии апоптозро пурра наҷот диҳад. Хус1 ҳуҷайраҳои шартии нокаут. (A) сатҳҳои p53 дар Hus1 flox /+ ва Хус1 flox/Δ1 MEFs пас аз сирояти Ad-cre. Фоизи ҳуҷайраҳои p53-мусбат дар вақтҳои нишондодашуда пас аз сироят тавассути таҳлили иммунофлуоресцентӣ муайян карда шуд. Арзишҳо шумораи миёнаи ҳуҷайраҳои p53-мусбат аз се майдони мустақили микроскопи 40 × бо сатрҳои хатогӣ SD мебошанд. $B) Таҳлили дучандшавии ҳуҷайраҳои зерин Хус1 ғайрифаъолкунӣ дар а саҳ53- заминаи камбуд. MEF-ҳои генотипҳои нишондодашуда дар гузаргоҳи дуюм бо Ad-cre сироят ёфтаанд ё бо тақаллуб сироят ёфтаанд ва сипас мувофиқи ҷадвали гузариши 3T3 парвариш карда мешаванд. PDL-ҳои ҷамъшуда тарҳрезӣ шудаанд. $C) Камбудињои мукаммали сикли њуљайрањо дар пай Хус1 ғайрифаъолкунӣ дар а саҳ53- заминаи камбуд. MEF-ҳои сироятшудаи Ad-cre аз генотипҳои нишондодашуда бо BrdU нишонгузорӣ карда шуданд ва тавассути цитометрияи ҷараён, ки дар ривояти расми 2 тавсиф шудааст, таҳлил карда шуданд. Фоизи ҳуҷайраҳо дар ҳар як марҳилаи давраи ҳуҷайра нишон дода шудааст. $D) Апоптоз пас аз шартї Хус1 ғайрифаъолкунӣ дар а саҳ53- замина нол. MEF-ҳои генотипҳои зикршуда бо Annexin V-FITC ва PI ранг карда шуданд ва тавассути цитометрияи ҷараён таҳлил карда шуданд. Сюжетҳо фоизи ҳуҷайраҳои апоптозро нишон медиҳанд (Занимаи V мусбат, PI манфӣ). Арзишҳо миёнаи се таҷрибаҳои мустақил бо сатрҳои хатогӣ SD-ро ифода мекунанд. $E) Ҷамъшавии γ-H2AX дар Hus1 flox /+ саҳ53 −/− ва Хус1 flox/Δ1 саҳ53 −/− MEFs пас аз сирояти Ad-cre. Фоизи ҳуҷайраҳои γ-H2AX-мусбат тавассути таҳлили иммунофлуоресцентӣ, тавре ки дар ривояти расми 3 тавсиф шудааст, муайян карда шуд.

Мо минбаъд мустақиман нақши p53-ро дар нуқсонҳои паҳншавии ҳуҷайраҳо ва афзоиши апоптоз, ки пас аз шартан ба вуҷуд меоянд, озмоиш кардем. Хус1 зарбаи мадҳушкунанда. Бо ин максад мо ба меднаткашон Хус1 ҳуҷайраҳои шартии нокаут дар а саҳ53- заминаи камбуд. Хус1 flox/Δ1 саҳ53 +/+ , Хус1 flox/Δ1 саҳ53 −/− , Hus1 flox /+ саҳ53 +/+, ва Hus1 flox /+ саҳ53 −/− MEFs бо Ad-cre сироят ёфтаанд ва аз рӯи ҷадвали гузариши 3T3 парвариш карда шуданд. Монанд ба натиҷаҳои расми 2B, Ad-cre – сироятшуда Хус1 flox/Δ1 саҳ53 +/+ ҳуҷайраҳо дар аввал дучанд шуданд ва инчунин аз Ad-cre сироят ёфтанд Hus1 flox /+ саҳ53 +/+ MEFs, аммо онҳо пас аз 4 dpi дучанд камшударо нишон доданд (Расми 5B). Таъсири Хус1 ғайрифаъолкунӣ дар як монанд буд саҳ53-заминаи нокифоя, гарчанде ки умуман саҳ53-ҳуҷайраҳои нул нисбат ба онҳо ду маротиба тезтар афзоиш ёфтанд саҳ53 ҳамтоёни навъи ваҳшӣ. Махсусан, Ad-cre - сироятшуда Хус1 flox/Δ1 саҳ53 −/− ҳуҷайраҳо ду баробар зиёд шуданд ва инчунин Ad-cre-сироятшуда Hus1 flox /+ саҳ53 −/− MEFs то 4 dpi, вале баъдан коҳиши дучандро нишон дод, ки дар баробари мушоҳидашуда дар саҳ53 +/+ ҳуҷайраҳо. Ҳамин тариқ, саҳ53 ҳазф кард, нуқсони дучанд ҳуҷайраҳои дар шартан наҷот надод Хус1 ҳуҷайраҳои нокаут. Ин таҷрибаҳоро аз 7 dpi зиёд кардан мумкин набуд, зеро фарҳангҳо аз ҳад зиёд шуданд Хус1 flox/Δ1 саҳ53 −/− ҳуҷайраҳое, ки гузаранда натавонистанд Хус1 нест кардан. Аз рӯи blot Southern, ин ҳуҷайраҳо, ки дар онҳо аллели шартӣ рекомбинатсияшуда боқӣ мемонд, фавран пас аз сирояти Ad-cre хеле кам буданд, аммо онҳо аксарияти фарҳангро 7 dpi ташкил медиҳанд (маълумот нишон дода нашудааст).

Барои муайян кардани он, ки оё p53 пас аз он ба дигар вокунишҳо ба ноустувории геномӣ миёнаравӣ кардааст Хус1 талафот, мо таъсири минбаъдаро дида баромадем саҳ53 норасоии тақсимоти давраи ҳуҷайра ва апоптоз дар Хус1 ҳуҷайраҳои шартии нокаут. Мутобиқи натиҷаҳо дар расми 2B, дар профилҳои сикли ҳуҷайраҳои Хус1 flox/Δ1 саҳ53 +/+ ва Hus1 flox /+ саҳ53 +/+ ҳуҷайраҳо дар 2 dpi (Расми 5C). Аммо, тавре ки қаблан мушоҳида шуда буд, дар Ad-cre сироятшуда шумораи хурд, вале назарраси ҳуҷайраҳои BrdU-манфии S-фаза (S2) (3,08%) мавҷуд буд. Хус1 flox/Δ1 саҳ53 +/+ фарҳангҳо бо 5 dpi. Ба ҷои боздоштани ҷамъшавии ҳуҷайраҳои S2, саҳ53 нокифояӣ воқеан басомади онҳоро ба таври назаррас афзоиш дод, зеро 9,11% аз Ad-cre сироятшудагон Хус1 flox/Δ1 саҳ53 −/− ҳуҷайраҳо дар фраксияи S2 дар 5 dpi мавҷуд буданд. саҳ53 несткунӣ инчунин натавонист афзоиши нисбии апоптозро, ки бо шартӣ алоқаманд аст, пешгирӣ кунад Хус1 ғайрифаъолкунӣ, гарчанде ки он новобаста аз он, боиси коҳиши умумии апоптоз гардид Хус1 ҳолати (Расми 5D). Мувофиқи натиҷаҳои расми 2D барои саҳ53- ифодакунандаи MEFs, 14,1 ± 2,2% аз Ad-cre - сироятшуда Хус1 flox/Δ1 саҳ53 +/+ ҳуҷайраҳо дар 7 dpi апоптоз буданд, дар ҳоле ки 8,8 ± 2,6% аз Ad-cre сироятшуда Hus1 flox /+ саҳ53 +/+ ҳуҷайраҳо дар як вақт апоптоз буданд. Ба ҳамин монанд, 10,8 ± 1,2% аз Ad-cre-сироятшуда Хус1 flox/Δ1 саҳ53 −/− ҳуҷайраҳо дар 7 dpi апоптотикӣ буданд, дар муқоиса бо танҳо 3,7 ± 0,8% аз Ad-cre сироятёфта Hus1 flox /+ саҳ53 −/− ҳуҷайраҳо. Кӯтоҳаш, саҳ53 талафот дар шартан афзояндаи апоптозро пахш карда натавонист Хус1 ҳуҷайраҳои нокаут ва бадтар кардани нуқсонҳои сикли ҳуҷайра, ки бо онҳо алоқаманданд Хус1 ғайрифаъолшавӣ.

Ниҳоят, мо озмоиш кардем, ки оё саҳ53 норасоӣ ба андозаи ҷамъшавии DSB дар шартан таъсир мерасонад Хус1 ҳуҷайраҳои нокаут. Дар Ad-cre-сироятшуда басомади пасти ҳуҷайраҳои γ-H2AX-мусбат вуҷуд дошт Hus1 flox /+ саҳ53 −/− фарҳангҳо. 1,2 ± 0,5% ин ҳуҷайраҳо дорои беш аз 10 фокусҳои γ-H2AX дар 7 dpi буданд (Расми 5E), ки бо натиҷаҳои аз Ad-cre сироятёфта муқоиса кардан мумкин аст Hus1 flox /+ саҳ53 +/+ фарҳангҳо (Расми 3B). Фарҳангҳои бо тақаллуб сироятёфтаи ҳама генотипҳо сатҳи якхелаи пасти рангкунии γ-H2AXро нишон доданд (маълумот нишон дода нашудааст). Ҷолиб он аст, ки омехта саҳ53 камбудӣ бо шартӣ Хус1 ғайрифаъолшавӣ кам нашуд, балки ба ҷои он каме баланд шудани рангкунии γ-H2AX нисбат ба таъсири Хус1 танҳо талафот. Мо муайян кардем, ки 21,1 ± 1,5% аз Ad-cre сироят ёфтааст Хус1 flox/Δ1 саҳ53 −/− MEFs дорои фокусҳои >10 γ-H2AX дар 7 dpi (Расми 5E) дар муқоиса бо 16,9 ± 3,9% аз Ad-cre сироятшуда Хус1 flox/Δ1 саҳ53 +/+ MEFs (Расми 3B). Якҷоя, натиҷаҳо нишон медиҳанд, ки саҳ53 талафот ҷамъшавии зарари геномро дар шартан кам намекунад Хус1 ҳуҷайраҳоро нокаут мекунанд ё нуқсонҳои паҳншавии ҳуҷайраҳо ва апоптозро дар натиҷа пахш мекунанд.


ХРОМАТИН ва танзими пайдоиши репликатсия

Интихоб ва фаъолсозии пайдоиши репликатсияи ДНК бояд дар доираи муҳити хроматинии маҳаллӣ сурат гирад. Тадқиқотҳои барвақте, ки намунаҳои воридшавии тимидинҳои радиоактивиро тафтиш мекунанд, нишон доданд, ки доменҳои мушаххаси хромосомӣ дар марҳилаҳои S дар вақтҳои дискретӣ такрор карда мешаванд (Голдман ва дигарон 1984). Эухроматини аз ҷиҳати транскриптӣ фаъол дар аввали марҳилаи S такрор карда шуд, дар ҳоле ки гетерохроматини конденсатсионӣ ва аз ҷиҳати ген камбизоат дар охири марҳилаи S нусхабардорӣ карда шуд. Ин ва таҷрибаҳои шабеҳ (Stambrook and Flickinger 1970) пешниҳод карданд, ки муҳити маҳаллии хроматин на танҳо ба барномаи транскрипсия, балки ба барномаи репликатсияи ДНК низ таъсир мерасонад.

Дар S. cerevisiae, пайдоиши репликатсияи ДНК бори аввал ҳамчун унсурҳои пайдарпайии мухтори такроршаванда (ARS) муайян карда шуданд, ки барои тарғиб ва нигоҳ доштани эписома заруранд. Ҳар як ARS қисман аз ҷониби degenerate муайян карда мешавад cis-унсури пайдарпайии амалкунанда, ки пайдарпаии консенсусии ARS (ACS) номида мешавад. ACS барои функсияи пайдоиш зарур аст, аммо кофӣ нест (Celniker et al. 1984), зеро дар геноми хамиртуруши ба мотиви ACS >10,000 мувофиқат мавҷуд аст (Breier et al. 2004). Аммо, <400 аз он мувофиқатҳои эҳтимолии ACS ҳамчун маконҳои ҳатмии софдилона барои комплекси шинохти пайдоиш (ORC) амал мекунанд (Сю ва дигарон 2006).Ҳамин тариқ, дигар хусусиятҳои хромосомӣ эҳтимолан дар муайян кардани пайдоиши репликатсия иштирок мекунанд.

Сарфи назар аз консерватсияи ORC ва дигар транс-омилҳои амалкунанда, ки барои васлкунии комплекси пеш аз репликативӣ (пеш аз RC) ва боркунии геликази Mcm2–7 дар ибтидо заруранд, нигоҳ дошта нашудаанд. cis-унсурҳои амалкунанда, ки репликаи ДНК-ро роҳбарӣ мекунанд, дар эукариотҳои олӣ муайян карда шудаанд (Гилберт 2004). Бар хилофи дар S. cerevisiae, ORC тозашуда аз эукариотҳои олӣ дар vitro хусусияти пайдарпайро кам ё тамоман нишон медиҳад (Vashee et al. 2003 Remus et al. 2004). Якҷоя ин натиҷаҳо метавонанд нишон диҳанд, ки интихоби пайдоиш ва оғози такрорӣ рӯйдодҳои тасодуфӣ ё стохастикӣ дар эукариотҳои олӣ мебошанд, аммо таҳқиқоти сершумор пайдоиши мушаххаси репликатсия ва инчунин ҳатмии ORC дар маконҳои мушаххас ва такроршавандаи хромосомаро муайян кардаанд (Остин ва дигарон, 1999 Ладенбургер ва дигарон. 2002 Карнани ва дигарон 2010 МакАлпин ва дигарон 2010). Ҳамин тариқ, бар хилофи аломатҳои пайдарпай, ки ба интихоби пайдоиш дар хамиртуруш мусоидат мекунанд, детерминантҳои пайвастшавии ORC дар эукариотҳои олӣ пеш аз ҳама аз муҳити хроматинии маҳаллӣ вобастаанд.

Якҷоя ин натиҷаҳо нишон медиҳанд, ки ҳам дар эукариотҳои поёнӣ ва ҳам болотар ташкил ва сохтори хроматини маҳаллӣ хусусиятҳои муҳими интихоби пайдоиш мебошанд. Дар ҳақиқат, таҳқиқоти охирин дар системаҳои сершумори модели таҷрибавӣ нақши тағиротҳои гистонӣ ва ташкили хроматинро дар танзими барномаи репликатсияи ДНК қайд карданд.

Тағйироти гистон ва танзими пайдоиш

Тачрибахо дар S. cerevisiae ахамияти мухити махаллии хроматинро дар танзими вазифаи пайдоиш нишон дод. Дар хамиртурушҳо, генҳо дар наздикии ақсои хромосома аксар вақт аз ҷониби Sir2p, як HDAC хомӯш карда мешаванд ва маъмулан дер такрор мешаванд (баррасӣ дар Руше ва дигарон, 2003). Таъхир дар фаъолсозии пайдоиш дар наздикии теломерҳо бо пайдарпайӣ ба вуҷуд намеояд, зеро интиқоли ARS501, як пайдоиши дер фаъолкунандаи теломерӣ, ба минтақаи дигари геном фишори теломерии фаъолшавии пайдоишро сабук кард (Фергюсон ва Фангман 1992). Ба ҷои ин, репрессияи фаъолсозии пайдоиш дар наздикии теломер аз сабаби сохтори маҳаллии хроматин аст ва вайроншавии ин сохтор ба пешравии оташи ибтидоӣ дар марҳилаи S оварда расонд (Стивенсон ва Готчлинг 1999). Ба наздикӣ, таҳлили геномӣ оид ба вақте, ки пайдарпаии мушаххас дар марҳилаи S такрор карда мешаванд, робитаи возеҳро бо фаъолияти транскрипсия ва вақти такрорӣ дар инсон муайян кардааст (Birney et al. 2007 Ryba et al. 2010), муш (Hiratani et al. ал. 2010), Дрозофила (Schübeler et al. 2002 MacAlpine et al. 2004), ва ҳуҷайраҳои мурғ (Hassan-Zadeh et al. 2012). Минтақаҳои геномези аз ҷиҳати транскриптӣ фаъоли геном пеш аз минтақаҳои геном бо фаъолияти ками ген такрор карда мешаванд. Таносуби байни вақти такрорӣ ва фаъолияти транскриптсионӣ на дар сатҳи генҳои инфиродӣ, балки бо фаъолияти васеи транскрипсияи доменҳои калони хромосомаҳо муайян карда мешавад (MacAlpine et al. 2004). Тааҷҷубовар нест, ки байни тағиротҳои хроматин, ки бо транскрипсияи фаъол ва репликатсияи барвақт алоқаманданд, робитаи қавӣ вуҷуд дорад. Таҷрибаҳо аз лоиҳаи энсиклопедияи унсурҳои ДНК (ENCODE) муайян карданд, ки пайдарпаии дар марҳилаи аввали S аз ҳуҷайраҳои HeLa такроршуда барои фаъол кардани аломатҳои хроматин (H3K4Me2 ва H3K4Me2) ва инчунин гиперацетилизатсияи гистонҳои H3 ва H4 ғанӣ шудаанд (Бирни ва дигарон 2007) . Дар таҳқиқоти сершумори мустақил аз як қатор системаҳои модели эукариотӣ (Hiratani et al. Schwaiger et al. 2008 Schwaiger et al. 2009 Lee et al. 2010) чунин робитаҳои васеъ байни вақти такрорӣ ва фаъолсозии тағироти гистонҳо дар таҳқиқоти сершумори мустақил гузориш дода шудаанд. Ҳамоҳангсозии возеҳ байни барномаҳои транскрипсия ва репликатсия метавонад, қисман аз сабаби маҳаллисозии зуд-зуд пайдоиши репликатсия дар наздикии маконҳои оғози транскрипсия бошад (Cadoret et al. 2008 Cayrou et al. 2011).

Мушкилоти ацетилизатсияи гистон ба барномаи репликатсия таъсир мерасонад. Дар сурати мавҷуд набудани Rpd3, HDAC, дарозии марҳилаи S, эҳтимолан аз сабаби фаъолсозии қаблии зермаҷмӯи пайдоиши такрорӣ кӯтоҳ мешавад (Vogelauer et al. 2002). Дарвоқеъ, таҳлили геномии фаъолияти пайдоиш дар сурати мавҷуд набудани Rpd3 боиси фаъол шудани қариб 100 ибтидои дер оташфишонии такрорӣ гардид (Кнот ва дигарон 2009). Афзоиши маҳаллии ацетилизатсияи гистон, ки тавассути пайваст кардани Gcn5, як ацетилтрансферазаи гистон ба пайдоиши дер фаъолкунанда, инчунин оғозёбии пайдоишро хеле пештар дар марҳилаи S мусоидат кард (Vogelauer et al. 2002). Нақши ацетилизатсияи гистон дар пешбурди репликатсия ба хамиртуруш хос нест, зеро ҷалби Чамо (Hbo1), Дрозофила гистон ацетилтрансфераза (нигаред ба поён), ба фаъолияти репликатсияи локуси хорион ҳавасманд карда шудааст (Аггарвал ва Калви 2004). Ба ҳамин монанд, ҳадафи фаъолияти HAT ё HDAC ба макони В-глобин метавонад вақти такроршавиро мутаносибан аз дер ба барвақт ва баръакс гузаронад (Goren et al. 2008). Ин натиҷаҳо ба таври возеҳ нишон медиҳанд, ки тағироти маҳаллӣ дар ацетилизатсияи гистон қодир ба танзими фаъолияти пайдоиш мебошанд.

Бозёфтҳои ба наздикӣ дар бораи он, ки домени Orc1 бромо-ҳамшафати гомология (BAH) махсусан лизини диметилонидашудаи 20-и гистони H4-ро мепайвандад (Kuo et al. 2012) нишон медиҳад, ки H4K20me2 метавонад барои ҷалби ORC ба хроматин ва муайян кардани пайдоиши такрорӣ муҳим бошад. Мутацияҳо дар домени Orc1 BAH ва инчунин дигар ҷузъҳои пеш аз RC боиси синдроми Мейер-Горлин, як шакли нодири ибтидоии карликизм мешаванд (Bicknell et al. 2011). Ғайр аз он, аз даст додани Suv4-20h1 / h2, метилтрансфераза, ки барои H4K20me2 масъул аст, боиси нуқсонҳои шабеҳи рушд ба синдроми Мейер-Горлин дар зебравӣ мегардад, ки нақши муҳимро барои диметилизатсияи H4K20 ва барномаи репликатсияи ДНК ҳангоми рушди муқаррарӣ нишон медиҳад (Куо ва дигарон. 2012). Бо вуҷуди ин, бояд қайд кард, ки H4K20me2 фаровонтарин тағирёбии гистон аст, ки >85% сатҳҳои гистони H4-ро дар муш ташкил медиҳад (Schotta et al. 2008). Ба ҳисоби миёна, 97% ҳамаи нуклеосомаҳо ҳадди аққал як гистони H4K20me2 доранд, ки баҳс карданро душвор мекунад, ки H4K20me2 омили хос барои ORC аст. Ба ҷои ин, H4K20me2 метавонад танҳо барои мӯътадил кардани ORC дар хроматин кӯмак кунад ва дигар хусусиятҳои хромосомӣ ҳамчун омилҳои мушаххаси пайдоиш амал мекунанд.

Ба ҷои таъсир расонидан ба маҳаллисозии ORC, таҷрибаҳои нав нишон медиҳанд, ки муҳити хроматинии маҳаллӣ метавонад боркунии геликази репликативиро дар G танзим кунад.1. Hbo1 (пайвастагии гистон ацетилаза бо ORC) як ацетилтрансферазаи фаровони гистон аст, ки барои қисми зиёди ацетилизатсияи гистон H4 дар геномҳои ширхӯрон масъул аст ва дар аввал дар асоси таъсири мутақобилаи он бо ORC, Mcm2 ва Cdt1 муайян карда шудааст (Iizuka and Stillman 1999 Burke et al. Izuka 1999). ва дигарон 2006). Дар Ксенопус иқтибосҳои Hbo1 барои монтажи пеш аз RC лозим аст (Iizuka et al. 2006) ва ҷалби сунъии Hbo1-и каталитикӣ ғайрифаъол ба пайдоиши ширхӯрони репликатсия ба боркунии геликазаи Mcm2-7 таъсири манфӣ мерасонад (Miotto and Struhl 2010). Ҷолиб он аст, ки ба монанди бисёр сафедаҳои дорои фаъолияти HAT, Hbo1 қобилияти ацетил кардани сафедаҳои ғайригистонӣ, аз ҷумла Orc2, Mcm2 ва Cdc6 дар in vitro дорад (Burke et al. 2001). Ҳамин тариқ, комилан равшан нест, ки оё нақши Hbo1 дар танзими пайдоиш аз сабаби ацетилизатсияи мушаххаси гистонҳо ё алтернатива, ацетилизатсияи ҷузъҳои пеш аз RC аст.

Таҷрибаҳои шабеҳ инчунин нишон медиҳанд, ки сатҳи монометилизатсияи H4K20 барои боркунии геликаз ва ташаккули пеш аз RC муҳим аст (Tardat et al. 2007). Set8, ки бо номи PR-Set7 низ маълум аст, як метилтрансферазаи бо давра танзимшавандаи ҳуҷайра мебошад, ки гистон H4-ро дар лизин 20 монометилат мекунад (Fang et al. 2002 Nishioka et al. 2002). Set8 ба протеазома дар марҳилаи S аз ҷониби E3 ubiquitin ligase Crl4 ба таври вобаста ба PCNA нигаронида шудааст (Abbas et al. 2010 Centore et al. 2010 Oda et al. 2010). Сатҳи Set8 барои нигоҳ доштани устувории геномӣ муҳим аст, зеро аз даст додани функсияи Set8 ба таъхири марҳилаи S, деконденсатсияи хромосомаҳо, афзоиши зарари ДНК, G оварда мерасонад.2 боздошт ва амплификацияи центросома (Караченцев ва дигарон 2005 Йоргенсен ва дигарон 2007). Ба ҳамин монанд, мӯътадилшавӣ ва аз ҳад зиёд ифода кардани Set8 низ ба ҳуҷайра зараровар аст, ки дар натиҷа фишурдани бармаҳал ва такрори хроматин мешавад (Тардат ва дигарон 2007). Эҳтимол, такрори такрорӣ, ки тавассути мӯътадилсозии Set8 ба вуҷуд омадааст, қисман ба ташаккули фоҳишаи пеш аз RC вобаста аст, зеро афзоиши маҳаллӣ дар H4K20me ва ҷалби ҷузъҳои пеш аз RC ҳангоми пайваст шудани Set8 ба як макони мушаххас мушоҳида мешавад (Тардат ва дигарон 2007). . Фаҳмидани он ки чӣ гуна ҳолати метилизатсияи лизин 20 (моно-, ди- ё триметилизатсия) тавассути давраи ҳуҷайра танзим карда мешавад ва таъсири он ба локализатсияи ORC, маҷмӯи пеш аз RC ва устувории геном бешубҳа як соҳаи фаъол ва муҳими тадқиқоти оянда хоҳад буд. .

Ҷойгиркунии нуклеосома ва интихоби пайдоиш

Таҷрибаҳои барвақт дар эпизоме, ки дорои ARS1, an S. cerevisiae пайдоиши репликатсияи ДНК, нуклеосомаҳои хуб ҷойгиршударо муайян карданд, ки пайдарпаии пайдоишро фаро мегиранд (Симпсон 1990). Таҳлили маълумоти ҷойгиршавии нуклеосомаҳои геномӣ аз S. cerevisiae ошкор намуд, ки қариб ҳама унсурҳои ARS аз нуклеосомаҳои умда кам мешаванд (Mavrich et al. 2008a). Таҳлили минбаъдаи ҷойгиршавии нуклеосомаҳо нисбат ба самти 17-bp ACS, на унсурҳои ба таври васеъ хариташудаи ARS, нуклеосомаҳои дақиқ ҷойгиршударо муайян карданд, ки қариб ҳама пайдоиши хамиртуруши репликатсияро фаро мегиранд (Berbenetz et al. 2010 Eaton et al. 2010). Ҳамин тариқ, нуклеосомаҳои ҷойгиршуда, ки бори аввал дар ARS1 дар плазмид мушоҳида мешаванд, хусусияти муайянкунандаи S. cerevisiae пайдоиши репликатсияи ДНК. Ғайр аз он, камшавии ишғоли нуклеосомаҳо дар пайдоиши репликатсия дар организмҳои гуногуни эукариотӣ берун аз он низ мушоҳида шудааст. S. cerevisiae, аз ҷумла Дрозофила (MacAlpine et al. 2010), ҳуҷайраҳои ширхӯрон (Lubelsky et al. 2011) ва Schizosaccharomyces pombe (Givens et al. 2012).

Модели пайдошаванда ин аст, ки дар S. cerevisiae, ACS ва аломатҳои пайдарпайии поёноб минтақаи пайдоишро аз ҳамла ба нуклеосомаҳо озод нигоҳ медоранд ва ин минтақаи бузурги аз нуклеосомаҳо ҷойгиршавии ORC-ро осон мекунад (расми 4). Пас аз пайвастшавӣ, ORC ва эҳтимолан фаъолияти азнавсозии хроматин аз ATP вобаста барои тавлиди массиви нуклеосомаҳои хуб ҷойгиршуда, ки дар паҳлӯи пайдоиши репликатсия ҷойгиранд, лозим аст (Итон ва дигарон 2010). Ҷолиб он аст, ки агар ҷойгиршавии нуклеосомаи болооб тағйир ёбад, боркунӣ ва оғозёбии Mcm2-7 халалдор мешавад, ки ин нишон медиҳад, ки меъмории хроматин барои монтажи пеш аз RC ва фаъолсозии пайдоиш муҳим аст (Липфорд ва Белл 2001). Бо вуҷуди ин, якчанд саволҳои муҳим боқӣ мемонанд. Чӣ тавр ҷойгиркунии нуклеосомаҳо, гардиш ва хориҷшавӣ ба боркунӣ ва фаъолсозии пайдоиши Mcm2-7 мусоидат мекунанд? Кадом фаъолиятҳои азнавсозии хроматин аз ATP вобастаанд ва чӣ гуна онҳо ба фаъолсозӣ, вақт ва самаранокии пайдоиш мусоидат мекунанд? Фаҳмидани он, ки сохтори хроматини маҳаллӣ чӣ гуна таъсир мерасонад ва танзим мекунад, ки нисбатан хуб муайян карда шудаанд S. cerevisiae Барномаи репликатсияи ДНК барои фаҳмидани он ки чӣ гуна муҳити хроматини маҳаллӣ ва динамика ба пластикии интихоби пайдоиш дар эукариотҳои олӣ мусоидат мекунад, муҳим хоҳад буд.

Ташкили нуклеосома дар пайдоиши реплика. Табиати бойи AT-и ACS ва пайдарпаии паҳлӯ дар S. cerevisiae пайдоиши репликатсия воридшавии нуклеосомаҳоро ба пайдоиш пешгирӣ мекунад. Минтақаи бидуни нуклеосома дар пайдоиши репликатсия дар хамиртуруш ва эукариотҳои олӣ мушоҳида мешавад ва метавонад ҳамчун муайянкунандаи асосӣ барои пайвастшавии ORC амал кунад. Ҳангоми пайваст кардани ORC нуклеосомаҳои паҳлӯ ба таври дақиқ ҷойгир мешаванд ва ин мавқеъ аз ORC ва фаъолияти азнавсозии хроматин аз ATP вобаста аст. Минтақаи бидуни нуклеосома дар ибтидо метавонад ба боркунии комплексҳои сершумори Mcm2-7 ва рӯйдодҳои минбаъдаи ДНК пеш аз оғоз шудан мусоидат кунад.


Усулҳо

Таҳлили филогенетикӣ

Мо бо истифода аз барномаҳои BioEdit (версияи 7.0.0) базаҳои пурраи cDNA-и биринҷ, NCBI [http://www.ncbi.nlm.nih.gov/] ва GRAMENE [http://www.gramene.org/]-ро ҷустуҷӯ кардем. 5.3) ва MEGA (версияи 3.1) барои муайян кардани гомологҳои биринҷи RecQ. Дар биринҷ ҳафт гомологҳои RecQ мавҷуданд. Таҳлили филогенетикӣ дар асоси ҳамоҳангсозии пайдарпаии аминокислотаҳо, ки аз ҷониби барномаи дарунсохташудаи CLUSTALW тавлид шудааст, анҷом дода шуд.

Синтези cDNA OsRecQl4 ва ҷудокунии osrecql4хатҳои мутант

РНК-и умумӣ аз ниҳолҳои 7-рӯза бо истифода аз маҷмӯаи RNeasy Plant Mini (Qiagen) мувофиқи протоколи аз ҷониби истеҳсолкунанда додашуда ҷудо карда шуд. Транскрипсияи баръакс бо истифода аз ReverTra Ace (Toyobo, Ҷопон) мувофиқи дастурҳои аз ҷониби истеҳсолкунанда пешниҳодшуда бо РНК-и умумӣ аз пойгоҳи тирчаи биринҷ анҷом дода шуд. Реаксияи занҷири полимеразӣ (PCR) ва амплификацияи босуръати ақсои cDNA (RACE) бо истифода аз боэътимодии баланди термостабли полимеразаи ДНК, KOD-Plus (Toyobo, Ҷопон) анҷом дода шуд. 5'- ва 3'-RACE бо истифода аз маҷмӯаи GeneRacer (Invitrogen, Carlsbad, CA) бо праймерҳои мушаххаси ген, ки мувофиқи пайдарпаии геномии ДНК тарҳрезӣ шудаанд, иҷро карда шуданд. Примерҳои мушаххаси ген барои тақвияти минтақаи рамзгузории OsRecQl4 RecQl4_Start1 (GCCATGATAAAGCCAAGGGTCAACT) буданд ва праймерҳо барои амплификатсияи дарозии cDNA RecQl4_End1 (ACCCTAGGCTATTCTGGCGGACTG), RecQCCTTCAGACG4) ва RecQCCTTCAGG4 (ACCCTAGGCTATTCTGGCGACTG) ва RecQCCTTCAGG4') буданд. . Маҳсулоти PCR ба вектори pCR2.1 TOPO (Invitrogen, Сан Диего, CA) барои пайдарпайии ДНК клон карда шуданд.

Тухмҳои хатти барчаспшудаи T-DNA osrecql4-1 ва хати воридкунии Tos17 osrecql4-2 мутаносибан аз коллексияҳои POSTECH (хати No 3A-03503) [50] ва NIAS (хати No NC2763) гирифта шудаанд [51]. Тухмиҳое, ки аз растаниҳои гетерозигота гирифта шудаанд, дар хок парвариш карда шуданд ва тухмиҳои барои хати воридкунии T-DNA ва Tos17 минбаъд дар гармхона паҳн карда шуданд.

Ҷойҳои ҳамгироии T-DNA ва Tos17 тавассути ПТР бо истифода аз праймерҳои зерин муайян карда шуданд: барои ворид кардани T-DNA, комбинатсияҳое, ки барои сарҳади чап ё рости Т-ДНК хосанд: pGA2715-L1.5 (GGCCAGTGAATTCACTAGTGATTGC), 3A -03503-498 F (CAATCCATCCTCGAAAGGCAAT), 3A-03503-498R (ATTCGCGAGGCCATCTCTCT) ва барои воридкунии Tos17: Tos17_3880 (AGTCGCTGATTTCTTCACCAAGG), NC2763-FGTCCTTG2, gene NC2763-FGTTCCG2) ва genc NC2763-FGTTCCG2) Маҳсулоти PCR тоза ва пайдарпай шуданд (Тасвири 1А).

Таҳлили blot Northern

Маҷмӯи РНК аз маслиҳатҳои навдаҳои ниҳолҳои 10-рӯза бо истифода аз маҷмӯаи мини RNeasy Plant (Qiagen, Валенсия, Калифорния) омода карда шудааст. РНК-и умумӣ (20 мкг) ба гели 1% агароз бор карда, ҷудо карда шуд ва ба мембранаи нейлони мусбат заряднок (Рош, Мангейм, Олмон) интиқол дода шуд. Ёридиҳандаро A (OsRecQ4-proN_F, AACACAAAGGCCTAATCAGGAAGCA OsRecQ4-proN_R, ATTCCTGGTGTAAATCGGTGATTGG) ё $ B (RecQl4_1F, GTCGAAAAAGATGTGACCAACATTGCTAG RecQl4_1R, TCCCGTCCACTTGACTCTGTTGATTAG) (расми 1А) бо истифода аз як таҳқиқи ЗМФ кобед синтези маҷмӯаи (Roche) омода шуд, ва hybridization мувофиқи дархост кофта иљро шуд Дастур (Roche). Гибридизатсия дар 50 ° C ва шустан дар шароити сахт дар 50 ° C анҷом дода шуд.

Табобат бо агентҳои вайронкунандаи ДНК

Барои омӯзиши таъсири агентҳои вайронкунандаи ДНК ба биринҷ, мо захираи 10 мг/мл цисплатин (CDDP, cis-diamminedichloroplatinum [II] Wako Pure Chemical Industries, Токио, Ҷопон), 10 мг/мл захираи блеомицин (BLE) омода кардем. Wako Pure Chemical Industries), 10 мг/мл захираи афидиколин (APH Wako Pure Chemical Industries), 10 мг/мл захираи нокодазол (NOC Wako Pure Chemical Industries) ва 1 мм захираи камптотецин (CPT Wako Pure Chemical) Саноат).

Барои таҳлили таъсири агентҳои вайронкунандаи ДНК ба дарозшавии реша, тухмиҳои стерилизатсияшуда дар муҳити сахти MS, ки дорои агентҳои вайронкунандаи ДНК мебошанд, кошта шуданд ва дар камераи афзоиш дар 30 ° C дар зери нури доимӣ парвариш карда шуданд. Панҷ рӯз пас аз кишт, дарозии реша бо истифода аз нармафзори Image J (версияи 1.43) чен карда шуд.

Барои омода кардани маводи растанӣ барои ранг кардани PI ва санҷиши TUNEL, мо растаниҳои биринҷи 5-рӯзаи дар муҳити сахти MS парваришшударо ба муҳити моеъи MS, ки дорои консентратсияи гуногуни агентҳои вайронкунандаи ДНК мебошанд, интиқол додем ва сипас барои 24 соати дигар дар камераи афзоиш инкубатсия кардем. Барои таҳлили кометаҳо, калли 4-ҳафтаинаи дар муҳити сахти N6D парваришшуда ба муҳити моеъи N6D интиқол дода шуданд, ки дорои агентҳои вайронкунандаи ДНК мебошанд ва сипас барои 1 соати дигар дар RT инкубатсия карда шуданд.

PI ранг кардани нӯги реша

Маслиҳатҳои реша, ки тақрибан 10 мм аз нӯги реша бурида шудаанд, бо 5 мг/л PI (дар оби стерилизатсияшуда) барои 20 дақиқа дар шишаи слайд ранг карда шуданд.

TUNEL (таҳлили терминали дезоксинуклеотидил трансфераза бо миёнаравии dUTP ник ва тамғагузорӣ)

Решаҳо дар як шабонарӯз бо 4% (в/в) параформальдегид дар PBS (pH 7.4) дар 4°C мустаҳкам карда шуданд. Баъдан, решаҳои собит дар як қатор терт-бутанол хушк карда шуданд ва дар парапласт барои қисмат ҷойгир карда шуданд. Намунаҳо дар силсилаи дараҷаи этанол ба об барои тоза кардани параформальдегид, пеш аз коркард бо протеиназа К (20 мкг/мл протеиназа К дар 10 mM Tris-HCl, рН 7,5) дар 37 ° C барои 30 дақиқа регидрат карда шуданд ва сипас се маротиба шуста шуданд. маротиба бо PBS. Реаксияи TUNEL дар шишаи слайд бо истифода аз маҷмӯаи муайянкунии марги ҳуҷайраҳои In Situ бо флуоресцеин (Roche) мувофиқи дастурҳои истеҳсолкунанда анҷом дода шуд.

Таҳлили комета

Слайдҳои микроскопӣ бо қабати агарози нуқтаи обшавии муқаррарии 1% пешакӣ пӯшонида шуда, бодиққат хушк карда шуданд. Калли дар 200 мкл PBS, ки дорои 50 mM EDTA бо теғи ришдор бурида шудааст. 30 мкл аз суспензияи ҳосилшудаи ядроҳо бо ҳаҷми баробари моеъи агарозаи пасти обшавии 1% дар 42 ° C омехта карда шуд ва дар слайдҳои микроскоп қаблан бо агарозаи 1% нуқтаи обшавии муқаррарӣ пӯшонида шуд. Пас аз сахтшавии агарозаи дорои ядроҳо, ядроҳо дар маҳлули баланди намаки (2,5 М NaCl, 10 mM Tris-HCl pH 7,5, 100 mM EDTA) барои 20 дақиқа дар ҳарорати хонагӣ ба лизис дучор шуданд. Мувозинат барои 3 × 5 дақиқа дар 1 × TBE рӯи ях пас аз электрофорез дар ҳарорати хонагӣ дар буфери 1 × TBE барои 6 дақиқа. Барои тоза кардани гелҳои донаҳои крахмал, ки дар суспензияи ҳастаӣ мавҷуданд, слайдҳо дар давоми 10 дақиқа дар 1% Тритон пеш аз деградатсия барои 2 × 5 дақиқа дар 70% этанол ва 96% этанол ва хушккунии ҳаво нигоҳ дошта шуданд. Гелҳои агарозии хушк бо ранги сабзи 1:10,000 SYBR иловашуда ранг карда шуданд. Пас аз ранг кардан, слайдҳо дар зери микроскопи флуоресцентӣ бо истифода аз нармафзори микроскопи Leica DM5000 гирифта шуданд ва зарари ДНК бо истифода аз нармафзори CometScore ™ миқдорӣ муайян карда шуд.

Микроскопия

Тасвирҳои нӯги решаи бо PI оғушташуда тавассути микроскопи Keyence (BZ-9000) бо функсияи Z-stack гирифта шудаанд. Функсияи Z-stack нуқтаи марказии линзаи объективиро тавассути меҳвари Z интиқол медиҳад, якчанд тасвирҳоро мегирад, танҳо нуқтаҳои фокусиро аз тасвирҳо ҷудо мекунад ва нуқтаҳоро ба тасвири ҳама-фокалӣ синтез мекунад (http://www.keyence. com/products/microscope/fluorescence/bz8000/bz8000_features_3.php). Барои аксбардорӣ микроскопи Leica DM5000 низ истифода шудааст.

Табдили биринҷ

Агробактериум- табдили миёнаравии биринҷ (О. Сатива L. cv. Nipponbare) тавре иҷро карда шуд, ки қаблан тавсиф шуда буд [52, 53]. Тухмиҳои пошида стерилизатсия карда шуданд ва дар муҳити N6D барои 1 ҳафта сабзида шуданд. Пас аз кишти культивацияи Агробактериум ки вектори pGU.C.US-ро мебардоранд, калли сироятшуда 7 маротиба бо оби стерилизатсияшуда ва се маротиба бо 12,5 мг/л меропенем шуста шуд. Каллиҳо ба муҳити N6D интиқол дода шуданд, ки дорои антибиотикҳои мувофиқ барои интихоби ҳуҷайраҳои табдилёфта мебошанд. Калли, ки дар муҳити интихобӣ шадид афзоиш ёфтааст, ба муҳити барқароркунандаи дорои антибиотикҳо гузаронида шуд. Растаниҳои барқароршуда минбаъд дар муҳити бидуни гормонҳои MS парвариш карда шуданд ва сипас дар хок шинонда шуданд.

Рангкунии гистохимиявии GUS

Рангҳои гистохимиявии маводи растанӣ тавре сурат гирифт, ки Ҷефферсон [54] тавсиф кардааст. Барои осон кардани воридшавии буфери ранга, растаниҳо ба сегментҳои тақрибан 10 мм бурида шуданд ва калли калон ба якчанд қисмҳо тақсим карда шуданд. Ин маводҳои растанӣ бо субстрати рангкунии X-Gluc барои 3 × 10 дақиқа вакуум ворид карда шуданд ва сипас дар 37 ° C барои 3 рӯз инкубатсия карда шуданд. Калли баъдан бо 70% этанол сафед карда шуд ва шумораи доғҳои кабуди GUS ҳисоб карда шуд.


Видеоро тамошо кунед: ДНК на отцовствоТест на отцовства: Фальсификация и достоверность (Феврал 2023).