Маълумот

Чӣ тавр ҳисоб кардани титри вирус аз qPCR

Чӣ тавр ҳисоб кардани титри вирус аз qPCR


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ман аз ҳуҷайраҳои 293T каме лентивирус гирифтам ва мехоҳам натиҷаро титр кунам. Ман 293T ҳуҷайраҳоро дар табақи чоҳҳо бо 400,000 ҳуҷайра дар як чоҳ сироят кардам, ки ман ба захираи вирусҳо сироят кардам ва 1 дар 10, 100 ва 1000 размҳо (инчунин чанд чоҳи безарар). Пас аз 72 соат инкубатсия ман ҳуҷайраҳоро трипсинизатсия кардам ва аввал FACS -ро барои титр истифода бурдам, аммо 293T промоутерро ифода намекунад, ки дар он GFP дар баъзе намунаҳо ҷойгир аст ва аз ин рӯ инҳо дар FACS пайдо намешаванд. Ҳамчун алтернатива, ман бо истифода аз маҷмӯаи QIAGEN DNeasy аз ҳама намунаҳо ДНК -и геномиро гирифтам (инчунин намунаҳое, ки ман тавонистам онро аллакай FACS титр кунам) ва сипас дар онҳо qPCR гузарондам.

Ман ABI PRISM 7000 SDS -ро истифода кардам: http://www.cgenetool.com/products/abi_prism_7000.shtml

Дар лавҳаи PCR дохил карда шудаанд:

  • Стандартҳои рақамӣ: 1000, 10k, 100k, 1m нусха
  • Намунаҳо дар се нусха
  • Назорати бе шаблон ва инчунин назорати интиқолнашуда

Ҳар яке аз онҳо дучанд карда шуд, як маротиба бо праймерҳо ва зонд барои WPRE (унсури хос барои лентивирус) ва як маротиба бо праймерҳо ва зонд барои бета-актин (гене, ки дар ҳама ҳуҷайраҳо мавҷуд аст).

Натиҷаҳое, ки мошин бармегардонад, барои ҳар як чоҳ давраеро дар бар мегирад, ки дар он флуоресценсияи остона гузашт - дар якҷоягӣ бо миқдори худкор ҳисобкардашудаи нусхаҳо (ки нармафзор аз стандартҳое, ки ман гумон мекунам).

Азбаски ман намунаҳои сегонаеро якхела номбар кардам, он инчунин ба таври худкор миқдори миёнаи ҳар се нусхаро ҳисоб кард (амалӣ, ҳа?). Ман санҷидам, ки оё ягон чизи берунӣ вуҷуд дорад, ки бояд аз воситаҳо хориҷ карда мешуд, аммо ҳамааш хуб буд.

Ҳоло, масалан, ман натиҷаи 700k барои миқдори WPRE дар намунаи А дорам. Миқдори бета-актин дар намунаи А 6.82 x 10 буд6. Трансфексия 400,000 ҳуҷайра дар як чоҳ буд, намунаи А бо 10uL захираи вирусӣ дар 1:100 маҳлул карда шуд.

Чӣ тавр ман метавонам унвони вирусро дар як мл ҳисоб кунам?

Ба ман формула додаанд: WPRE Qty / (b-act Qty * 0.5) * ҳуҷайраҳои хуб (400k) * омили омехта (100), аммо ман барои фаҳмидани он а) барои чӣ б-амали Qty ба 2 тақсим мешавад, б) оё натиҷа титри вирус дар як uL ё дар 10 uL хоҳад буд (ҳаҷми интиқол) ва в) чӣ гуна бета-актин метавонад тақрибан 10 бошад7 рақамҳои нусхабардорӣ дар ҳама намунаҳо пайваста, вақте ки онҳо бояд тақрибан 10 бошанд5 ҳуҷайраҳо …


Ман дар ин ҷо 2 шубҳа дорам.

  1. Шумо вирусҳои худро аз васоити ахбори омма ба даст меоред, дар ҳоле ки ченкунии Actb метавонад танҳо дар лизатҳои ҳуҷайра анҷом дода шавад.
  2. Actb танҳо як истинод ба эътидол овардани шумораи ҳуҷайраҳо аст: шумораи ҳуҷайраҳо баландтар бошанд, титри вирусӣ аз сабаби шумораи зиёди ҳуҷайраҳои сироятшуда зиёдтар хоҳад буд. Аммо ин аҳамият надорад, агар ҳадафи шумо интиқоли лентивиралӣ бошад, ки шумо танҳо ба гирифтани арзишҳои титрӣ манфиатдоред ва самаранокии ташаккули онро чен намекунед.

Шумо метавонед танҳо бо намунаи медиа ва стандартҳо qPCR иҷро кунед ва арзишҳои ченшудаи Ct-и намунаҳоро барои ба даст овардани титрҳо регресс кунед.


Усули шумо ба назари ман хеле мураккаб менамояд. Албатта, шумо вируси назоратӣ доред? Ман як сохтори ифодаи таркибии GFP -ро тавсия медиҳам, то онро бо таҳлили FACS мувофиқ созад. Вируси GFP -ро барои мустақиман ҳисоб кардани титри вирус аз ҷониби FACS истифода баред ва сипас дигар вирусҳои худро тавассути таҳлили лавҳа тасдиқ кунед.


Пас аз он ки таҷрибаи бештар дар бораи чӣ гуна кор кардани тадқиқот, ман воқеан ба худам ҷавоб дода метавонам:

а) миқдори бета-актин ба 2 тақсим мешавад, зеро он як гени инсон аст ва аз ин рӯ ду маротиба дар ҳуҷайраҳои ширхӯрон мавҷуд аст, ки ба 2 тақсим кардани он миқдори ҳуҷайраҳои мавҷударо ҳисоб мекунад.

б) Натиҷа тахмин мезанад, ки чанд нусхаи вирусӣ дар ҳуҷайраҳо хотима меёбад миқдори маҳлули вируси истифодашуда - Ҳамин тариқ, агар он 10 uL аз 1: 100 буд, ин 0,1 л маҳлули тозаи вирусро ифода мекунад. Ҳамин тариқ, воҳиди натиҷа дар ин ҳолат "сироятҳои вирусӣ ба 0.1uL" хоҳад буд.

в) Миқдори нусхаҳои бета-актин ба шумораи ҳуҷайраҳои дар аввал тухмшуда мувофиқат намекунад. 400к ҳуҷайра, ки тақрибан дар як 24 соат як маротиба ду баробар мешаванд, пас аз 72 соат 3,2 миллион ҳуҷайраро ташкил медиҳанд (3,2x10).6) Пас, ин ҳама аз рақами нусхабардорӣ хеле дур нест.


а) Триптон агар:-
Ба 1 л об 10 г Триптон, 0,01-0,03 М хлориди калсий (реактив), 5 г хлориди натрий ва 11 г агар илова кунед. Бо ташвиқоти зуд-зуд гарм кунед ва 1 дақиқа напазед, то хокаро пурра ҳал кунед. Автоклав дар ҳарорати 121°C барои 15 дақиқа.
б) шўрбои триптони: -
Тавре ки дар боло зикр шудааст, бидуни илова кардани агар дар миёна.
в) агар триптон нарм агар:-
Ба 1 л об 10 г Триптон, 5 мл хлориди калий ва 9 г Агар илова кунед. Бо ташвиқоти зуд-зуд гарм кунед ва 1 дақиқа напазед, то хокаро пурра ҳал кунед. Автоклав дар ҳарорати 121 дараҷа ва 15 дақиқа.

Азбаски вирусҳо метавонанд ба консентратҳои бениҳоят баланд афзоиш ёбанд, мо бояд онҳоро самаранок ҳисоб кунем, то онҳоро самаранок ҳисоб кунанд. Татбиқи фарҳанги бактериофагро иҷро кунед.
Ҳама қубурҳои дилрезӣ ва расонаҳоро ба таври зерин нишонгузорӣ кунед. Ҳар як найча даҳ маротиба коҳиш ёфтани вирусро ифода мекунад
а) Панҷ найчаи агар нарми триптони: 10 -5, 10 -6, 10 -7, 10 -8, 10 -9
б) Панҷ лавҳаи агар сахти триптони: 10 -5, 10 -6, 10 -7, 10 -8, 10 -9
в) Даҳ найчаи шўрбои триптони: 10 -1 то 10 -10

Маҳлули силсилавӣ

  • Дастпӯшакҳо пӯшед, 9 мл шўрбои триптонро ба даҳ найчаи парвариши 10 -1 то 10 -10 пур кунед. Ин найчаҳо барои густариши силсилавии вирусҳо истифода мешаванд.
  • 1 мл захираи фарҳанги фагро, ки мехоҳед титр кунед ва ба найчаи таҳти унвони 10 -1 бо пипетка интиқол диҳед. Тубаро хуб омехта кунед. Ин аввалин разряди даҳкаратаи шумост.
  • Аз қубури худ бо нишони 10 -1 1 мл фарҳанги омехтаро гиред ва бо пипеткаи нав ба найчаи навбатии нишони 10 -2 интиқол диҳед. Ин қубурро низ омехта кунед.
  • Ин намунаро барои эҷоди як силсилаи изолятсия идома диҳед. Шумо бо 9 найчаи 9 мл ва 1 найчаи 10 мл ба охир мерасед. Борҳои вирусӣ дар найҳои шумо дар ҳама ҷо аз 10 маротиба (найчаи аввалини шумо) ё 100 маротиба (найчаи дуввуми шумо) то даҳ миллиард маротиба (найчаи охирини шумо) пароканда карда мешаванд.

Тайёр кардани табақҳо

  • Панҷ қубур аз агараи триптони мулоим ва панҷ табақчаи Петри бо номи 10 -5 то 10 -9 гиред
  • Панҷ найчаи мулоими триптонии агар нишонгузоршударо дар ваннаи об ҷойгир кунед. Об бояд чуқурии каме болотар аз қубури агар дар қубурҳо бошад. Барои гудохтани агар ваннаи обиро ба 100˚C биёред. Агар агар гудохташударо дар 45˚C хунук кунед ва нигоҳ доред. Ин кафолат медиҳад, ки агар шумо имкони рехтани онро ба табақҳои петри дошта бошед, агар дар найҳо мустаҳкам нашавад.
  • Асептикӣ ду қатра фарҳанги Escheria coli B -ро бо пипетаи Пастер ба агар интиқол диҳед ва оҳиста омехта кунед. Инҳо бактерияҳое мебошанд, ки кушта мешаванд ва ба шумо имкон медиҳанд, ки шумораи зарраҳои вирусро дар маҳлули мушаххас ҳисоб кунед.
  • Ҳангоме ки найчаҳо дар ваннаи оби гарм ҳастанд, ба ҳар найчаи мулоими агар 0,1 мл аз ҳар як иловагии сериявӣ илова кунед. Масалан, 0,1 мл маҳлули силсилавии 10 -5 шумо бояд ба найчаи агари нарм бо нишони 10 -5 ворид шавад.
  • Бо истифода аз пипеткаҳои алоҳидаи Пастер ва маслиҳатҳои пипеткаҳои безарар, қадами қаблиро барои найҳои маҳлули шўрбои фагҳои триптони бо нишони 10 -6 то 10 -9 такрор кунед.
  • Қубурҳоро хуб омехта кунед ва сипас ҳар як найчаро ба лавҳаи Петри бо нишони мувофиқ рехт. Ин як қабати тунуки агарро эҷод мекунад, ки дар ҳар як табақ бо бактерияҳо ва вирусҳо эм карда шудааст. Ҳама фарҳангҳои табақро дар ҳолати баръакс барои 24 соат дар 37 ˚C инкубатсия кунед

Ҳисоб ва ҳисобкунии титрҳо

Титрии вирусӣ як ченаки миқдории фаъолияти биологии вируси шумо мебошад ва ҳамчун воҳидҳои ташаккулёбии лавҳа (pfu) дар як мл ифода карда мешавад.
Барои ҳисоб кардани титри вирус,

  • Табақҳои худро аз инкубатор бароред ва онҳоро тафтиш кунед. Шумо бояд дар саросари табақ ҷойҳои абрнокро бинед, ки дар он бактерияҳо афзоиш ёфтаанд, ба истиснои доғҳои хурди шаффоф, ки онҳоро плакҳо меноманд. Ин лавҳаҳо часпакҳои бактерияҳои мурда мебошанд ва ҳар як лавҳа як вирусро ифода мекунад.
  • Табақеро пайдо кунед, ки аз 30 то 300 лавҳа дорад ва шумораи дақиқи лавҳаҳоро дар он табақ ҳисоб кунед.
  • Пас формулаи зеринро барои муайян кардани титр (pfu/ml) -и захираи вирусии худ истифода баред.

Дар куҷо, d = маҳлул
v = ҳаҷми вируси иловашуда ба табақ илова карда шудааст

Ҳисоби намуна:


&bull Ба ҳисоби миёна 50 лавҳа дар чоҳҳои маҳлули 1:10,000 ташкил карда шудааст.
& bull Ҳаҷми вируси иловакардашуда: 0,2 мл

Мутаассифона, ин лабораторияи виртуалӣ Adobe Flash Player -ро талаб мекунад. Лутфан маълумоти иловагӣ нигаред, агар ин дар компютери шумо кор накунад

Дар мошинҳои GNU/Linux, лутфан ба кӯмаки мувофиқи онлайн нигаред. Барои намуна,


C чист?q Арзиш?

ПТР дар вақти воқеӣ (одатан qPCR номида мешавад) одатан барои миқдор кардани миқдори мутлақи пайдарпаии ҳадаф ё муқоисаи миқдори нисбии пайдарпаии ҳадаф байни намунаҳо гузаронида мешавад. Ин техника тақвияти ҳадафро дар вақти воқеӣ тавассути сигнали флуоресцентии мушаххас, ки ҳангоми тақвият дода мешавад, назорат мекунад.

Сарфи назар аз он, ки рангҳо ва пробҳои флюоресценти ПТР дар вақти воқеӣ бояд мушаххас бошанд, миқдори зиёди флуоресценти замина дар аксари таҷрибаҳои вақти воқеии ПТР ба амал меояд. Барои ба даст овардани маълумоти пурмазмун дар бораи ҳадафи худ, гузаштан ё ба ҳисоб гирифтани ин сигнали замина муҳим аст. Ин масъала бо ду арзиш дар PCR дар вақти воқеӣ ҳал карда мешавад: хати ҳадди аксар ва Cт арзиш.

  1. Хати остона сатҳи ошкор ё нуқтаест, ки реаксия ба шиддатнокии флуоресцент аз сатҳи замина мерасад. Пеш аз гузаронидани ПЗР, шумо (ё нармафзори сиклии шумо) сатҳи ҳадди ниҳоиро муқаррар мекунед. Ин аслан як хати графики шумост, ки сатҳи болотар аз флуорессенсияи заминаро ифода мекунад ва инчунин каҷи реаксияи шуморо дар ҷое дар оғози марҳилаи экспоненсиалии худ бур мекунад (Расми 1).
  2. Cq арзиш рақами давраи PCR аст, ки дар он хати реаксияи намунаи шумо бо хати остона мегузарад. Ин арзиш мегӯяд, ки барои муайян кардани сигнали воқеӣ аз намунаҳои шумо чанд давра лозим буд. Корҳои PCR дар вақти воқеӣ барои ҳар як намуна хатти реаксия доранд ва аз ин рӯ бисёр Cq арзишҳо. Нармафзори cycler & # 8217s шумо арзиши Cq-ро барои ҳар як намунаи шумо ҳисоб ва диаграмма мекунад.

Расми 1. Сатҳи остона ва C.q арзиши ҷадвали каҷи тақвияти ПТР дар вақти воқеӣ.

Cq арзишҳо ба миқдори кислотаи нуклеинии мақсадноки дар намунаи шумо буда баръакс мебошанд ва бо шумораи нусхаҳои мақсадноки дар намунаи шумо алоқаманд аст. Поёни С.q арзишҳо (одатан дар зери 29 давра) миқдори зиёди пайдарпаии ҳадафро нишон медиҳанд. Олӣ Cq арзишҳо (аз 38 давра) миқдори камтарини кислотаи нуклеинии мақсадноки шуморо ифода мекунанд. Баландии C.q арзишҳо инчунин метавонанд мушкилотро бо ҳадаф ё танзими ПТР нишон диҳанд, тавре ки баъдтар дар қисмати домҳои ин мақола оварда шудааст.

Асбоби ПТР -и шумо дар давоми ҳар як давра маълумоти флуоресценсиро ҷамъ мекунад. Пас аз тақрибан 15 давра, шумо дар бораи сатҳи флуорессенсияи пасзаминаи худ тасаввуроти хуб хоҳед дошт & # 8211 ин ҳамчун хати рост аз нуқтаи сифр оғоз мешавад. Сатҳи ҳадди аққал аз ин болотар хоҳад буд, аммо дар он ҷое, ки намунаҳои шумо ба марҳилаи экспоненсиалии тақвияти ПТР мегузаранд. Имрӯз, нармафзори компютерӣ ин нуқтаи дақиқро ҳисоб мекунад ва ҳамаи велосипедронҳои муосир дар вақти воқеӣ танзимоти хати остонаи автоматӣ доранд.

ПРР дар вақти воқеӣ миқдори флуоресценцияро ҳангоми реаксия, ки ҳама ҷузъҳои ПТР фаровон мебошанд, сабт мекунад. Бо ин роҳ, C.q арзишҳо одатан дар байни репликаҳо дар PCR дар вақти воқеӣ мувофиқанд. То расидан ба нуқтаи ниҳоии аксуламали ПТР, ингибиторҳои ҷамъшуда, полимеразаҳои ғайрифаъол ва реагентҳои маҳдудкунанда дар арзишҳои нуқтаи ниҳоӣ тағироти зиёд эҷод мекунанд ва аз ин рӯ PCR -и анъанавиро миқдоран истифода бурдан мумкин нест.


Дар VectorBuilder титри вирус чӣ гуна муайян карда мешавад? Пас аз ҷамъоварии зарраҳои вирусӣ, агар вектори вирусӣ як гени репортери флюоресцент дошта бошад, мо одатан аввал сифати вирусро тавассути интиқол додани вирус ба баъзе хатҳои ҳуҷайраҳои умумӣ (масалан, 293T ё 293A) тафтиш карда, ифодаи сафедаи флюоресцентро мушоҳида мекунем. Сипас барои муайян кардани титрии вирус вобаста ба намуди вирус усулҳои гуногун истифода мешаванд. Баъзан, агар дар байни мушоҳидаҳои флуоресценсионӣ ва ченкунии миқдорӣ фарқияти калон вуҷуд дошта бошад, мо дубора ченкунӣ ё тасдиқи иловагиро анҷом медиҳем, то боварӣ ҳосил кунем, ки вирусҳои истеҳсолкардаи VectorBuilder сифати баланд доранд.

Лентивирус

Мо барои чен кардани титри лентивирус p24 Elisa истифода мебарем. Ин усул барои санҷидани сатҳи протеини асосии ВИЧ-1 p24 дар супернатантҳои лентивиралӣ як иммуноанализи сэндвичро истифода мебарад. Намунаҳои лентивирус аввал ба табақаи микротитр илова карда мешаванд, ки чоҳҳои он бо антителои зидди анти-ВИЧ-1 p24 пӯшонида шудаанд, то p24 дар намунаҳои лентивирус банданд. Пас аз он илова кардани антителои дуввуми анти-p24 биотинилшуда, ки дар навбати худ ба p24, ки онро антителои аввал дар табақ гирифтааст, мепайвандад. Пас аз он конъюгат стрептавидин-HRP барои пайваст кардани антиденаи биотинии анти-p24 аз сабаби таъсири мутақобилаи стрептавидин ва биотин илова карда мешавад. Дар ниҳоят ба намунаҳо ҳалли субстрат илова карда мешавад, ки ҳангоми ҳамкорӣ бо HRP ранг истеҳсол мекунанд. Шиддати маҳсулоти ранга ба миқдори p24 дар ҳар як намунаи лентивирус мутаносиб аст, ки бо истифода аз спектрофотометр чен карда мешавад ва баъдан бо роҳи муқоиса бо каҷи стандартии рекомбинатии HIV-1 p24 дақиқ муайян карда мешавад. Пас аз он арзиши p24 бо титрии вирусии намунаи лентивируси мувофиқ мувофиқ карда мешавад.

Аденовирус

Барои аденовирус, мо инчунин титрии функсионалиро чен мекунем. Пас аз интиқол додани аденовируси сершумор ба ҳуҷайраҳои 293A, мо усули бар иммуноситохимия асосёфтаро истифода мебарем, то шумораи ҳуҷайраҳое, ки тавассути ошкор кардани протеини махсуси гексони аденовирус гузаронида мешаванд ва ҳар як ҳуҷайраи иммуностаиншуда ҳамчун як воҳиди сироятӣ ҳисобида мешавад. Ҳуҷайраҳо дар сатҳи хеле пасти сироят (MOI) сироят мешаванд, то боварӣ ҳосил кунанд, ки аксари ҳуҷайраҳои интиқолшуда ҳар як аз як заррачаи вирусӣ сироят мекунанд. Ин таҳлил робитаи хубро бо таҳлили анъанавии лавҳаҳо нишон медиҳад. Барои аденовируси ултра тозашуда, мо зичии оптикиро мустақиман чен мекунем (бо истифода аз OD260) зарраҳои вирусӣ барои муайян кардани титр, зеро дар байни зичии оптикии аденовируси ултра-тоза ва титрии функсионалӣ робитаи зич вуҷуд дорад. Аденовирус устувории хеле хуб дорад. Ҳангоми омодасозии мо, зарраҳои вирусӣ аслан ҳама зиндаанд ва метавонанд дар ҳарорати хонагӣ барои чанд рӯз кор кунанд.


1. Миёнаи арзиши Ct -ро барои генҳои нигоҳдорӣ ва гене, ки дар шароити таҷрибавӣ ва назоратӣ санҷида мешаванд, гиред ва 4 арзишро баргардонед. 4 арзиш генҳои таҷрибавии санҷидашуда (TE), назорати генҳои санҷишӣ (TC), таҷрибавии генҳои хонагӣ (HE) ва назорати генҳои хонагӣ (HC) мебошанд.

Миёнаи таҷрибавӣ Cт АрзишТаҷрибаи миёнаи C.т АрзишНазорати миёна Cт АрзишНазорати миёна Cт Арзиш Delta C.т Арзиш (таҷрибавӣ) Delta C.т Арзиш (назорат)
ТЕӮTCHC Delta CTE Delta CTC
21.2720.2319.6019.271.030.33

2. Фарқи байни арзишҳои таҷрибавӣ (TE - HE) ва арзишҳои назоратиро (TC - HC) ҳисоб кунед. Инҳо арзишҳои Delta Ct-и шумо барои шароити таҷрибавӣ ( Delta CTE) ва назорат ( Delta CTC) мебошанд.

3. Сипас, фарқи байни Delta CT барои таҷрибавӣ ва шартҳои назоратро ( Delta CTE - Delta CTC) ҳисоб кунед, то ба арзиши дукарата дельта Ct (ddCt) бирасед.

4. Азбаски ҳамаи ҳисобҳо дар асоси логарифми 2 ҳастанд, ҳар дафъае, ки ДНК ду маротиба зиёд бошад, қиматҳои Ct-и шумо 1 кам мешаванд ва ду баробар кам намешаванд. Шумо бояд арзиши 2 ^<-2 Delta Delta C_ -ро ҳисоб кунед> барои гирифтани тағйири қуттии ифода.

Арзиши dCt (таҷрибавӣ)Арзиши dCt (назорат)Арзиши ddCtТағироти пӯшиши ифода
dCTEdCTCddCt2^-ddCt
1.030.330.700.615572207


Чӣ тавр титри вирусро аз qPCR Ct ҳисоб кардан мумкин аст?

Ман бояд дар синфи микробиология титрҳои вирусро аз qPCR Ct ҳисоб кунам ва ман ҳеҷ маълумоте дар бораи чӣ гуна ин корро кардан пайдо карда наметавонам, ҳайронам, ки оё касе дар ин ҷо кӯмак карда метавонад?

Масалан, агар Ct 23,53 бошад, чӣ тавр ман онро ба титр табдил медиҳам?

Оё шумо стандартҳое доред, ки бо онҳо муқоиса кунед?

Бале. Барои ченкунии мутлақ ба шумо стандартҳо лозиманд. Арзишҳои Ct танҳо ба шумо мегӯянд, ки кадом намунаҳо GOI-и шуморо бештар ё камтар доранд.

Ба шумо лозим аст, ки стандартҳои худро дар каҷи стандартӣ графикӣ кунед ва сипас номаълумро графикӣ кунед. Бисёре аз нармафзори таҳлили qpcr ин корро барои шумо иҷро мекунанд, агар шумо ба унвони стандартҳо дохил шавед.

Шумо аз ҷиҳати техникӣ titre вирусро аз qPCR ҳисоб карда наметавонед. Шумо метавонед рақамҳои нусхабардориро гиред, ки метавонанд ба зарраҳо баробар шаванд.

Барои гирифтани титр шумо бояд миқдори маълуми вирусро ба ҳуҷайраҳо илова кунед ва PFU/mL-ро муайян кунед.

Агар кӯшиш кунед, ки нусхаҳоро пайдо кунед, тавре ки дигарон гуфтаанд, ба шумо каҷи стандартӣ лозим аст.


Арзиши Ct чист?

Арзиши ҳадди давра (Ct) -и реаксия ҳамчун рақами давра муайян карда мешавад, вақте ки флуоресценсияи маҳсулоти ПТР -ро дар болои сигнали пасзамина метавон муайян кард. Барои њисоб кардани ќимати Ct дар ќитъаи амплификатсия хатти уфуќї (остона) кашидан лозим аст. Ҷойгиркунии ин хат аксар вақт аз ҷониби нармафзори qPCR муайян карда мешавад, аммо корбарон метавонанд ин хатро дастӣ ҷойгир кунанд. Идеалӣ, остона дар он лаҳзае гузошта мешавад, ки реаксия дар марҳилаи экспоненсиалӣ қарор дорад, аз ин рӯ он бо сигнали пасзамина омехта карда намешавад.

Бо дидани мисоли дар боло овардашуда, метавон дид, ки рақами давра, вақте ки остона қитъаи тақвиятро убур мекунад, 19 аст. Аз ин рӯ, арзиши Ct дар ин ҳолат 19 хоҳад буд.

Арзиши Ct бо миқдори маҳсулоти ПТР дар реаксия алоқаманд аст. Чӣ қадаре ки арзиши Ct паст бошад, ҳамон қадар маҳсулоти PCR мавҷуд аст. Сабаб дар он аст, ки барои муайян кардани ин маҳсулот аз сигнали пасзамина давраҳои камтари PCR лозим аст.


Чаро RT-PCR, qPCR ва RT-qPCR яксон нестанд?

Ҳангоми муҳокимаи ин мавзӯъ, тасаввуроти нодурусти возеҳро таъкид кардан муҳим аст, ки RT-PCR, qPCR ва RT-qPCR синониманд. Дарвоқеъ, шабоҳатҳои байни усулҳои ба ҳам наздик аксар вақт боиси нодуруст истифода шудани ихтисорот мегардад. Бо мақсади пешгирии ин, Маълумоти ҳадди ақал барои интишори дастурҳои миқдории воқеии ПРР (MIQE), ки бори аввал дар соли 2009 нашр шуда буд, стандартизатсияи ихтисоротро пешниҳод кардааст. Онҳо изҳор доштанд, ки 'RT-PCR' бояд танҳо барои тавсифи PCR транскрипсияи баръакс истифода шавад, на PCR дар вақти воқеӣ, зеро аксар вақт иштибоҳ мекунанд. Транскрипсияи баръакси ПТР имкон медиҳад, ки РНК ҳамчун шаблон барои тавлиди ДНК -и иловагӣ (cDNA) истифода шавад. Бо истифода аз ферментҳои баръакси транскриптаза, як нусхаи як занҷири cDNA тавлид мешавад. Онро баъдан тавассути полимеразаи ДНК тақвият додан мумкин аст, ки cDNA-и дуқабатаро тавлид мекунад ва ба раванди амплификация дар асоси ПТР ворид мешавад (ниг. Расми 1А). Ин техникаро метавон дар клонкунии молекулавии генҳои шавқовар (GOIs) истифода бурд, аммо маъмулан он ҳамчун қадами аввал дар RT-qPCR хизмат мекунад. Мувофиқи MIQE, ихтисораи 'qPCR' тавсифи миқдори дақиқи ПТР-ро тавсиф мекунад, ки ин тақвияти ПТР-и ДНК дар вақти воқеӣ мебошад, ки бо проби флуоресцент чен карда мешавад, одатан рангҳои байниҳамдигарӣ ё зонд дар асоси гидролиз, ки имкон медиҳад миқдори ПТР маҳсулот (нигаред ба расми 1В). Ин усул барои муайян кардани мавҷудияти патогенҳо ва муайян кардани шумораи нусхаи пайдарпаии ДНК мавриди таваҷҷӯҳ истифода мешавад. Ихтисороти ниҳоии 'RT-qPCR' барои транскрипсияи баръакси миқдор дар вақти воқеии ПТР истифода мешавад. Ин усулест, ки RT-PCR бо qPCR-ро муттаҳид мекунад, то ченкунии сатҳи РНК тавассути истифодаи cDNA дар реаксияи qPCR имкон диҳад ва ба ин васила имкон медиҳад, ки тағироти ифодаи генҳо зуд муайян карда шавад (ниг. Расми 1С). Сарфи назар аз ин ихтисороти стандартӣ, бояд қайд кард, ки ин дастури номенклатура на ҳамеша риоя карда мешавад ва qPCR маъмулан барои тавсифи RT-qPCR истифода мешавад. Ба ин монанд, ҶТ барои ифодаи ПТР дар вақти воқеӣ истифода мешавад, на баръакси баръакс, бинобар ин дар он усул тавсиф карда мешавад. Барои ин Дастури шурӯъкунандагон, мо ихтисороти MIQE -ро тавре ки дар боло тавсиф шуда буд, истифода хоҳем бурд.

Муқоисаи схемавӣ RT-PCR, qPCR ва RT-qPCR. (A) Ҷараёни кории RT-PCR. РНК ҷудо карда мешавад ва cDNA тавассути транскрипсияи баръакс (RT) тавлид мешавад, пас барои васеъ кардани соҳаҳои таваҷҷӯҳ PCR гузаронида мешавад. (B) схемаи qPCR. ДНК ҷудо карда шудааст ва амплификатсияи тақвиятёфта бо истифода аз зонд, ки ҳангоми интеркалятсия бо ДНК-и дуқатораи флюорессионӣ ҳисоб карда мешавад. (C) Тартиби RT-qPCR. РНК ҷудо карда мешавад ва cDNA пеш аз оғози раванди qPCR тавлид мешавад.


Усулҳои алтернативии нормализатсия

Гарчанде ки нормализатсия ба генҳои истинод усули маъмултарин барои нормализатсияи таҳлил аст, ҳолатҳое мавҷуданд, ки ин равиш мувофиқ нест, масалан, вақте ки шумораи зиёди генҳо дар гурӯҳи гетерогении намунаҳо муқоиса карда мешаванд ё ҳангоми профилкунии miRNA. Дар ин сенарияҳо стратегияи алтернативиро қабул кардан лозим аст.

Нормализатсия ба массаи бофта ё рақами ҳуҷайра

Андозагирии рақами ҳуҷайра ё массаи бофтаҳо ҳамчун омили нормализатсия он қадар осон нест, ки он дар аввал зоҳир мешавад. Мувофиқ кардани таҷрибаҳои фарҳанги ҳуҷайра дар асоси шумораи ҳуҷайраҳо нисбатан осон аст. Бо вуҷуди ин, илова кардани табобат метавонад ба морфологияи ҳуҷайра таъсир расонад, ки таносуби шумораи ҳуҷайраҳоро ба умумии РНК/генҳо, ки ҳангоми муқоиса бо фарҳанги назоратӣ ифода шудааст, душвор созад. Табобати таҷрибавӣ метавонад боиси тавлиди матритсаи иловагии ҳуҷайра гардад, ки дар самаранокии истихроҷи кислотаи нуклеин фарқият эҷод мекунад.

Бофтаҳои биологӣ метавонанд дар дохили ва байни субъектҳо хеле гетерогенӣ бошанд ва ҳангоми муқоиса кардани бофтаи солим бо бофтаи бемор, фарқияти бештар ба назар мерасад. Ҳатто бофтаҳои аз афташ камтар мураккаб, ба монанди хун, метавонанд дар шумораи ҳуҷайраҳо ва таркиби он ба таври назаррас фарқ кунанд, ки ифодаи генҳо дар байни донорҳои солим хеле фарқ мекунад 18.

Ҳама гуна таъхир дар равандҳое, ки барои тоза кардани кислотаи нуклеин истифода мешаванд, боиси тағирёбии РНК-и ченшуда мегардад. Масалан, таъхир дар коркарди ҳуҷайраҳои мононуклеарии хуни периферӣ ва истихроҷи РНК аз ҳуҷайраҳо боиси тағироти назаррас дар ифодаи генҳо мегардад 19 . Усулҳое, ки дар асоси расмиёти истихроҷ қарор доранд, инчунин сарчашмаҳои асосии тафовути техникӣ мебошанд. Ҳатто раванди ҷудокунӣ, ки барои намуна гирифтани ҳуҷайраҳои ҳосилшудаи хун ва тозакунии РНК интихоб шудааст, боиси фарқият дар профилҳои зоҳирии генҳои 20 мегардад. Аз ин рӯ, аввалин баррасии меъёрсозӣ аз он иборат аст, ки ҷамъоварӣ ва коркард барои ҳама намунаҳо комилан якхела бошад. Пас аз он муҳим аст, ки назорати кофии сифат анҷом дода шавад, то ба консентратсияи намуна, якпорчагӣ ва покии намуна боварӣ дошта бошед (Тозакунии намуна ва Арзёбии сифат ва протоколҳои алоқаманд дар Замимаи А).

Нормализатсия ба консентратсияи РНК

Ҳадди ақал, арзёбии консентратсияи шаблон (ДНК барои qPCR ё РНК барои RT-qPCR) муҳим аст ва тавре ки дар Арзёбии сифат ва тозакунии намуна зикр шудааст, муҳим аст, ки як асбоб барои ҳама андозагирӣ истифода шавад, зеро муайянкунии Консентратсияи кислотаи нуклеин низ тағирёбанда аст ва аз техника вобаста аст.

Ҳангоми чен кардани консентратсияи умумии РНК, қисми зиёди намуна аз rRNA иборат аст ва танҳо як қисми хурде аз mRNA -и манфиатдор ҳангоми таҳқиқи ифодаи ген ё sncRNA ҳангоми омӯзиши танзими ифодаи генҳо иборат аст. Ин маънои онро дорад, ки агар консентратсияи rRNA ба миқдори каме зиёд шавад, аммо mRNA доимӣ боқӣ монад, консентратсияи умумии РНК афзоиш меёбад. Консентратсияи mRNA бояд ба таври назаррас афзоиш ёбад, то консентратсияи умумии РНК афзоиш ёбад. Аз ин рӯ, консентратсияи rRNA ченаки беэътимоди консентратсияи mRNA мебошад, аммо барои бисёр протоколҳо консентратсияи баробари РНК барои таъмини транскрипсияи дақиқи баръакс талаб карда мешавад (ниг. Транскрипсияи баръакс).

Нормализатсия ба ифодаи глобалии ген

Ҳангоми андозагирии шумораи зиёди ҳадафҳо, таҳлилгар метавонад маънои глобалии ифодаи умумии генро арзёбӣ кунад ва пайдарпаии танзимшавандаи РНК -ро, ки аз ин маъно фарқ мекунад, муайян кунад. Ин равиш одатан барои мӯътадилсозии массиви ифодаи генҳо истифода мешавад. Ин як алтернативаи арзишманд барои истифодаи генҳои истинод аст ва метавонад дар ҷойҳое, ки ҳадафҳои зиёд чен карда мешаванд, афзалтар бошад.

Равиши дигари ба наздикӣ омӯхташуда ин ченкунии унсурҳои такрории эндогенӣ (ERE) мебошад, ки дар дохили бисёре аз mRNAҳо мавҷуданд. Бисёр намудҳо ин унсурҳои такрориро дар бар мегиранд (ALU дар приматҳо, унсурҳои B дар мушҳо), ки метавонанд баҳодиҳии фраксияи mRNA-ро таъмин кунанд. Андозагирии ин пайдарпаии ҳадаф нишон дода шудааст, ки он ҳамчун системаҳои муқарраркунии муқаррарӣ 9 иҷро карда мешавад (Le Bert, et al., Дар омодагӣ) ва метавонад ҳалли универсалӣ ё алтернативаро барои таҷрибаҳои мураккабе пешниҳод кунад, ки дар онҳо комбинацияҳои устувори генҳои истинод мавҷуд набошанд.

Нормализатсияи маълумоти miRNA

Ҳанӯз дар бораи генаи универсалии истинод ба miRNA ягон гузориш нашудааст. Аз ин рӯ, интихоби системаи нормализатсия ҳоло ҳам таҷрибавӣ аст. Ҳангоми имконпазир, miRNA-ҳои устувори инвариантиро метавон аз равишҳои геномӣ муайян кард, яъне микроаррейҳо. РНКҳои хурди нуклеолярӣ (snoRNAs) низ ҳамчун генҳои истинод истифода шудаанд. Ифодаи глобалии генҳо инчунин як усули муфид барои ба эътидол овардани ифодаи miRNA мебошад, вақте ки истинодҳои устувор номаълум аст ва чандсад ҳадаф таҳлил карда шудааст 21,22,23. Ин усул барои онҳое, ки равишҳоро истифода мебаранд, ки дар натиҷа гирифтани ҳама miRNA -ҳоро ҳамчун cDNA дар шакли мултиплекс, масалан, системаҳои Exiqon ва miQPCR мувофиқтар аст (ба истинод ба Castoldi et al. Дар PCR Technologies, Innovations Current 24).

Нусхаҳои биологӣ ва техникӣ

Ҳадафи муқарраркунӣ пешгирӣ кардани хатогиҳои системавӣ ва кам кардани тағирёбии маълумот барои таҳлили омории ниҳоӣ мебошад. Ҷанбаи муҳими дигари ташкили маълумот барои таҳлили оморӣ истифодаи такрори маълумот мебошад.

Нусхаҳои биологӣ барои таҳлили оморӣ комилан заруранд. Сатҳи аҳамияти оморӣ аксар вақт дар ҳадди 5% аҳамият муқаррар карда мешавад. Барои таъсири биологӣ, ки ба чунин аҳамият наздик аст, шояд ҳадди аққал 20 нусхаи биологӣ барои муайян кардани сатҳи аҳамияти таҳлилҳо (1:20 ба 5%мувофиқ) лозим шавад. Дарвоқеъ, пешниҳод шудааст, ки барои баҳодиҳии дақиқи аҳамият 25, яъне аз рӯи ҳазор намунаи биологӣ ҳадди аққал 50 маротиба миқдори мушоҳидаҳо сабт карда шаванд. Табиист, ки маҳдудиятҳои амалӣ барои такрори биологӣ дар ин сатҳҳо хеле кам имкон медиҳанд. Ғайр аз он, ҳисобҳои дақиқи шумораи такрори зарурии биологӣ барои қонеъ кардани дараҷаи аҳамияти додашуда низ аз сатҳи тағирёбии маълумот вобаста аст. Бо вуҷуди ин, дарк кардан муҳим аст, ки иштибоҳи маъмул ин нодида гирифтани шумораи зарурии такрори биологӣ мебошад, то тавонанд хулосаҳои боэътимод бароранд. Тавсия дода мешавад, ки омӯзиши ибтидоии пилотӣ барои арзёбии тағирёбии хоси таҳлил ва андозаи потенсиалии таъсири мушоҳидаи биологӣ бо мақсади баҳодиҳии миқдори зарурии такрори биологӣ 26 гузаронида шавад.

Нусхаҳои техникӣ бевосита барои таҳлили оморӣ истифода намешаванд. Ба ҷои ин, нусхаҳои техникӣ барои нусхаҳои эҳтиётӣ истифода мешаванд (дар сурати гум шудани баъзе намунаҳо дар раванди коркарди техникӣ) ва барои беҳтар кардани арзёбии дурустии маълумот. Нусхаҳои техникӣ метавонанд дақиқии маълумотро такмил диҳанд, агар фарзия дуруст бошад, ки онҳо дар ҳар як марҳилаи раванди коркарди техникӣ стохастикӣ дар атрофи андозагирии дақиқ фарқ мекунанд. Миёнаи такрори техникӣ ба ченкунии дақиқ наздиктар аст. Таъсири миёнаи такрори техникиро метавон бо таваҷҷӯҳ ба андозаи фосилаи эътимод дар маҷмӯи додаҳои моделиронӣ бо тағирёбии пешакӣ муайяншуда, яъне инҳирофи стандартӣ, ки дар як ҷой гузошта шудааст, тасвир кардан мумкин аст. Тавре ки дар Ҷадвали 10.4, фосилаи эътимод бо зиёд шудани шумораи такрори техникӣ (намунаҳо) хурдтар мешавад, ки баҳодиҳии дақиқи ченкунии дақиқро нишон медиҳад. Ғайр аз он, тангии фосилаи эътимод аз ҳама камтар дар шумораи ками такрори техникӣ аст. Зиёд кардани шумораи такрорӣ аз 2-3 фосилаи эътимодро аз 8.99-2.48 коҳиш медиҳад, яъне беш аз 3 маротиба беҳтар шудани дақиқии баҳодиҳии ченкунии дақиқ. Дар ҳоле, ки такрорҳои иловагӣ такмил додани баҳодиҳии дурустии ченакро идома медиҳанд, таъсир ба андозаи коҳишёбанда аст. Аз ин рӯ, возеҳ аст, ки дар ҳолатҳое, ки тағирёбии коркарди техникӣ мушкилот аст, истифодаи се нусха ба ҷои дубликат метавонад бартарии бузург бошад.

Репликатҳои техникӣ метавонанд дар якчанд марҳила дар тамоми раванди коркарди намуна ҷамъоварӣ карда шаванд, аз ҷумла истихроҷи РНК, транскрипсияи баръакс ва муайянкунии qPCR. Агар такрори техникӣ дар якчанд марҳила ошкор карда шавад, тарҳи таҷрибавии лона сохта мешавад. Тадқиқоти озмоишие, ки аз тарҳи таҷрибавии лона истифода мебарад, метавонад барои муайян кардани марҳилаҳои коркарди намунаҳо, ки бештар ба хатогиҳои техникӣ мусоидат мекунанд ва нақшаи оптималии интихобро дар асоси ин маълумот ҳисоб кардан мумкин аст 27.


Санҷиши воқеии qPCR барои титри TYLCV дар робита бо тарозуи шиддати беморӣ дар асоси аломатҳо.

Дар давоми чанд даҳсолаи охир, бемории curl барги помидор (TYLCD) боиси талафоти зиёди ҳосил ва афзоиши ҳодисаҳо дар минтақаҳои тропикӣ ва субтропикӣ гардид. Дар Уммон шаш намуди мухталифи бегомовирусҳо бо TYLCD алоқаманданд. Бо вуҷуди ин, вируси curl баргҳои зарди помидор - Уммон (TYLCV-OM) намуди аз ҳама паҳншуда дар тамоми кишвар дониста шуд. Барои TYLCV-OM, ки дар асоси химияи SYBRGreen барои ошкор ва миқдори фаврии вирус асос ёфтааст, як таҳлили миқдорӣ дар вақти воқеӣ PCR (qPCR) бо назорати дохилӣ [омили дарозшавии помидор 1(EF1)] таҳия шудааст. Ин озмоиш дар намунаҳои саҳроӣ гузаронида шуд, ки аломатҳоро мувофиқи миқёси вазнини бемориҳои Маркази Ҷаҳонии Сабзавот (AVRDC) нишон медиҳанд. Ин озмоиш барои муқаррар кардани робитаи байни сарбории вирус ва нишонаҳои фенотипӣ истифода шудааст. Нусхаҳои вирусии 2,88 x 109 дар растаниҳои помидори саҳроӣ сироятшуда ошкор карда шуданд, ки шиддати аломатҳоро мувофиқи ҷадвали AVRDC '3' нишон медиҳанд (яъне, печиши шадиди баргҳо ва зардшавии баргҳо).

Шумораи нусхаҳои вирус бо коҳиши нисбии миқёси шиддати аломатҳо коҳиш ёфт. Растаниҳои помидоре, ки миқёси '1' ва '2' нишон медиҳанд, мутаносибан 7,7 x 104 ва 7,47 x 106 нусхаи вирусӣ доранд. Шумораи нусхаҳои хеле ками вирус (564) дар растаниҳои помидор ошкор карда шуд, ки аломатҳоро дар миқёси вазнинии '0' нишон медиҳанд, ки зоҳиран бе нишона буданд. Аммо, растаниҳои помидор, ки аз ҷониби фарҳанги бофтаҳо дар шароити стерилизатсияшуда таҳия шудаанд, ки ҳамчун назорати манфӣ истифода мешуданд, мавҷудияти вирусро нишон надоданд. Таҳлили таҳияшудаи qPCR метавонад то 18 фг (фемто грамм) вирусро аз кислотаи умумии нуклеинӣ ба тақрибан 30 воҳиди геномӣ муодил кунад. Ин таҳлили миқдорӣ метавонад барои муайян кардани титр вирус, дар барномаҳои зотпарварӣ барои рушди растаниҳои ба вирус тобовар ва тадқиқоти эпидемиологӣ барои назорат кардани популятсияҳои вирусӣ ва шиддатнокии онҳо истифода шавад.

Калидвожаҳо: TYLCV Lycopersicon esculentum

Майдонҳои помидор ба бемории ҷингила баргҳои помидор (TYLCD), ки яке аз харобиовартарин бемориҳои вирусӣ дар саросари ҷаҳон ба шумор меравад, зарари ҷиддӣ мебинанд. TYLCD инчунин омили асосии маҳдудкунандаи истеҳсоли помидор дар минтақаҳои гуногуни Шарқи Наздик ва Осиёи Ҷанубу Шарқӣ, Африқо, Аврупо (Czosnek and Laterrot, 1997 Moriones and Navas-Castillo, 2000) ва дигар кишварҳо (Accotto et al., 2000, 2003). Якчанд намуди вирусҳои аз ҷиҳати генетикӣ алоқаманд, ки ба насли Begomovirus аз оилаи Geminiviridae тааллуқ доранд, бо TYLCD алоқаманданд. TYLCD боиси талафоти зиёди ҳосил мегардад, ки метавонад то 100%расад. Паст кардани истеҳсоли помидор бо TYLCD алоқаманд аст, зеро он бори аввал дар охири солҳои 1930 тавсиф шуда буд. Cohen and Harpaz (1964) reported TYLCD in the Jordan valley which has now become a serious problem infecting tomatoes worldwide. TYLCV alone or by mixed infections of different Begomovirus species is responsible for total yield loss in different countries.

TYLCV is the generic name given to the complex of viral species that cause the disease. According to the International Committee on Taxonomy of Viruses (ICTV), a complex of more than 12 different viral species and their strains are found to be linked with TYLCD (Fauquet et al., 2008). TYLCV is transmitted in a circulative, persistent manner by its vector whitefly (Bimisia tabaci) (Moriones and Navas-Castillo, 2000).

The genome of TYLCV is monopartite with a single genomic component, containing single-stranded DNA (ssDNA). The size of this ssDNA molecule is about 2.8 kb. Symptoms appear approximately 15 days after whitefly inoculation. Infected plants have small leaves that curl upward and turn yellow around the margins. Infected plants have short internodes, and stunted appearance. They show premature flower fall and loss of fruits. Fruits are small, but not misshaped. Infection of the plant at earlier stages results in a greater yield loss. Most of the wild tomato species, such as Lycopersicon hirsutum, L. chilense, L. pimpinellifolium, and L. peruvianum are symptomless carriers (Zakay et al., 1991). In Oman TYLCD is associated with six begomoviruses but the most prevalent virus is TYLCV-OM which is found associated with almost all cases of the disease (Khan et al., 2014).

The range of symptom severity on tomato plants infected with TYLCD under field conditions varies from mild to severe. The Asian Vegetable Research and Development Center (AVRDC), currently known as The World Vegetable Center (WVC), Taiwan has established a disease severity scale 0-3 (four scales) for recording symptom severity, where 0 = no visible symptoms 1 = light leaf yellowing of the leaflet margins 2 = moderate plant stunting with leaf yellowing and curling and 3 = Severe plant stunting with leaf curling and yellowing and cessation of plant growth (Lapidot et al., 1997 Lapidot and Friedmann, 2002). The scale is important in scoring susceptibility/resistance of tomato breeding lines under diverse climatic and growing conditions.

Highly sensitive tests are required for the detection and quantification of the virus in epidemiological studies to understand host range and virus-vector relationship. Moreover, these tests can also help in the selection of lines in breeding programs as well as in understanding the mechanism of resistance in resistant lines developed through conventional and genetic engineering approaches. Several methods have been established to detect and identify different Begomovirus species infecting tomato crops, like immunoblotting (Pico et al., 1999), conventional polymerase chain reaction (PCR) methods, including species-specific primers and restriction fragment length polymorphism (Accotto et al., 2000 Martinez-Culebras et al., 2001 Davino et al., 2008), loop-mediated isothermal amplification (Fukuta et al., 2003) and real-time quantitative (q)PCR (Mason et al., 2008). PCR is one of the methods used extensively for the detection of begomoviruses.

The major drawback of conventional PCR is that it cannot determine the exact quantity of the virus. Moreover, some plants are phenotypically normal and carry very low virus titers which are below the detection limit of conventional PCR. So there is a need to quantify viruses in symptomatic as well as non-symptomatic plants.

The use of qPCR for the identification and quantification of DNA/RNA viruses has now become more attractive due to its greater accuracy and speed compared with conventional/end-point PCR or serological methods (Mason et al., 2008 Papayiannis et al., 2010). The use of an internal control in qPCR exhibits stable expression at various experimental conditions and allows normalization between samples. This kind of normalization is very effective in direct comparisons between independent samples and to avoid false negative results by removing any sampling, extraction or amplification bias that could hamper the analyses. In qPCR, several chemistries are available which include DNA binding dyes such as SYBR Green I, hybridization probes, hydrolysis probes and molecular beacon (Mullis and Faloona, 1987 Mullis, 1990 Tan et al., 1994 Huang et al., 1995a).

Binding of the SYBER Green I to the minor grooves of double stranded (ds)DNA results in emission of fluorescence 1000 folds >its free form in solution (Huang et al., 1995b). Thus, there is a direct correlation of fluorescence and synthesis of dsDNA in the reaction tube. This fluorescence can be determined which serves as the measure of amplified product. This method is relatively cheap and easy to use. Melt curve analyses can determine any nonspecific product during the reaction. In experiment, the fluorescence of the sample can be measured containing known DNA amounts in parallel to actual experimental reactions. The logarithm (log) of the amount of the starting quantities (SQ)versus threshold cycle (Ct) is used to plot standard curves to evaluate the reaction efficiency and to calculate the amount of DNA present in the experimental samples.

In this study, the enhanced sensitivity and specificity of qPCR was exploited for rapid detection and quantitation of TYLCV-OM using SYBR Green chemistry. This assay was then used on field infected tomato samples falling in different disease severity scales of AVRDC and the virus titer was correlated with symptom severity.

Field samples infected with TYLCV-OM were collected in January 2014 from Al'Seeb wilayat of Muscat, Oman. The samples were categorized according to AVDRC disease severity scale 0-3 (Zhengxing, 1999). Ten samples of each scale were collected along with healthy tomato plants.

DNA Extraction for Template Preparation

Total DNA was extracted from 0.1 g fresh Begomovirus-infected plant leaves by CTAB method (Doyle and Doyle, 1987).

For conventional PCR, TYLCV-OM specific primer pair FC (GATGGGTTCCCCTGTGCGTGAATCCAT) and RC (GGACCAGCCTCCTCTTATAGAGAATAT) was used for the confirmation of TYLCV-OM infection in all selected samples with the amplified product of 300 bp designed on CP region. The primer pair QF-OM (GAAGCCCTGATGTTCCCCGTGG) and QR-OM (GATTTAACACAGAACCTCTTACC) was designed based on the CP gene of TYLCV-OM and was used in qPCR reactions. To validate and standardize qPCR, an internal control EF1 (EF1-F: TACTGGTGGTTTTGAAGCTG and EF1-R: AACTTCCTTCACGATTTCATCATA) was designed and used. Clustal X program (Thompson et al., 1997) was used for multiple alignments.

For the absolute quantification of CP gene, a plasmid containing the full-length TYLCV-OM clone (Acc. No. DQ644565) was quantified with NanoDrop 8000 spectrophotometer (Thermo Fisher Scientific, USA) and serial dilutions were made to obtain a standard curve. The amount of viral DNA was used to calculate the copy number of the virus. The suitable amount of plasmid DNA was used to produce 1 X 109 copies of the virus and considered as stock. The stock sample was further 10-fold diluted to prepare five serial dilutions. A 10 ng uL-1 healthy tomato plant genomic DNA developed by tissue culture was also spiked in each serial dilution to get the same background as in field infected plants. All prepared standards were then aliquoted and frozen before being used as standards in each qPCR run. These serial dilutions were used to produce a standard curve.

The threshold cycle (Ct) value of three replicates of each standard-dilution and the log of the total DNA in each sample were used to obtain the standard curves by linear regression analysis.

A qPCR assay was done in Applied Biosystems(r) 7500 Real-Time PCR Systems (Life technologies, USA). The qPCR reaction mix consisted of (10 uL) of 1X Power SYBR Green master mix, 0.10 uL of each primer and 2.5 uL of DNA sample (10 ng uL-1). PCR reactions were carried out in clear optical plates in the ABI 7500 real time PCR detection system (USA).

Data analysis was done using ABI 7500 software v 2.0.6 for each template sample individually. The analysis includes the calculation of all parameters of the standard curves and their corresponding dissociation curves and also calculates the Ct values for each sample individually.

Infected Sample and Symptom Severity

During the field surveys, tomato plants exhibited a range of symptom severity (Fig. 1). The plants were categorized according to AVDRC disease severity scale (0-3). All plants showing symptom severity scale 1-3 upon PCR showed a band of 300bp indicative of the presence of Begomovirus infection. No amplification was observed in case of plants showing symptom severity scale 0 or healthy negative controls.

Primer Designing and Validation

The ClustalX program was used to make multiple sequence alignment of all TYLCV sequences available in the GenBank database reported from different geographical regions (Fig. 2). A list of viruses used in multiple alignment is given in Table 1. A highly conserved region in CP gene (co-ordinate 603-762) was selected for designing primers (Fig. 2). The amplicon size was 159 bp.

The other related and unrelated Begomovirus species were also checked by the primer QF-OM/QR-OM for their specificity and no amplification was obtained in any case either in conventional or qPCR assay (data not shown). More than 50 different TYLCV isolates from Oman were analyzed by multiple sequence alignment and indicated that all tested TYLCV sequences had a maximum of five nucleotide mismatches within the 159 bp of amplified region (Fig. 2).

The primer pair QF-OM/QR-OM was initially used to optimize qPCR profile and working concentrations on TYLCV-OM reference samples. For the optimization of the qPCR assays, various primer concentrations (2.5-10 pM) and annealing temperatures (50-65degC) were tested in a 15 uL reaction containing 2.5 uL (10 ng/uL) DNA template. 10 pM, 5 pM and 2.5 pM dilutions for both primer pairs were prepared for qPCR optimization. In case of QF-OM/QR-OM the primer concentration that yielded the highest reporter fluorescence with no dimer formations (100% efficiency) was 2.5 pM, while in case of the internal control primer pair EF1-F/EF1-R, the 10 pM concentration was found to be best. Melt curve analyses were studied in each run to see nonspecific amplifications. A single peak was observed in all cases indicative of the specific amplification.

Real-time qPCR Standard Curve

After optimization of all conditions, qPCR was programmed for 1 cycle at 94degC for 5 min, followed by 40 cycles each consisting of 30s at 94degC, 30s at 55degC and 30s at 72degC followed by a melt curve analysis starting from 55degC. Triplicate reactions of each sample were run. Each qPCR reaction was repeated thrice to ensure the reproducibility of results. The actual function of developed qPCR assay was the construction of quantification standard containing the five viral serial dilutions and the internal reporter gene. The plasmid containing full-length TYLCV-OM clone was quantified by nanodrop. The quantified plasmid was then serially diluted in 10-fold steps from 109 to 103 copies per uL. The Ct was automatically calculated by the ABI 7500 software. The efficiency of the reaction from the total nucleic acid (TNA) extracts was slightly higher (98.58%) than plasmid forms.

The Ct values of five10-fold serial dilution of TYLCV-OM plasmid was used to construct a standard curve, demonstrating the sensitivity and linearity of the technique. The Ct values were relative to the log starting quantity of template DNA and the qPCR efficiency. Plasmid and TNA from tomato plants infected with TYLCD was estimated by the formula E = [10-1/slope]-1, were 97.8% (slope: -3.367) and 98.58% (slope: -3.353), respectively.

Table 1: Accession numbers and origin of Begomoviruses used in the multiple sequence alignment

Accession No.###Acronym###Virus species###Origin

JN604488###TYLCV-[OM-DT2-12]###TYLCV###Mediterranean/Middle East, Iran

JN604484###TYLCV-[OM-KW1-12]###TYLCV###Mediterranean/Middle East, Iran

JN604485###TYLCV-[OM-KW2-12]###TYLCV###Mediterranean/Middle East, Iran

JN604486###TYLCV-[OM-KW3-12]###TYLCV###Mediterranean/Middle East, Iran

JN604487###TYLCV-[OM-DT1-12]###TYLCV###Mediterranean/Middle East, Iran

Sensitivity of Conventional and qPCR

The TYLCV-OM infected tomato DNA sample and TYLCV-OM plasmid DNA was used to compare the sensitivity of qPCR with conventional PCR. A 10-fold serial dilution of TNA (150 ng, 15 ng, 1.5 ng, 150 pg, 15 pg, 150 fg, 15 fg, 1.5 fg) from TYLCV-OM infected tomato plant was used as a template in qPCR and conventional PCR reactions. The minimum possible dilution accurately detected by conventional PCR was 150 pg, whereas qPCR was able to detect the last dilution point of 1.5 fg with Ct of 38.34. The qPCR reaction with 15 fg of template DNA was detected at a Ct of 34.95. In case of plasmid DNA, conventional PCR was limited to detect 3000 genomic units whereas qPCR detected as low as 30 genomic units. It was inferred from the observed results that the sensitivity of qPCR assay in detecting serial dilutions was 1000 times more (1:10-8) than the conventional PCR (1:10-5 Fig. 3).

Symptom Severity Scale and Virus Quantification

Before proceeding to qPCR, all field collected samples were first checked for the presence of TYLCV-OM by conventional PCR using the primer set FC and FR. All samples showing symptom severity scales of 1-3 showed the presence of TYLCV-OM, while no amplification was observed in case of samples showing a disease severity scale of 0 (Table 2). These results confirmed that TYLCV-OM is the prevalent virus and is present in all infected tomato plants in Oman. Five samples from each scale were selected for qPCR analysis. Each sample was run in five replicates.

The Ct values for scale 1were more than scale 2 and 3 (Fig. 4). Virus copies were detected in small amounts in tomato plants showing a symptom severity scale of 0. The amount of virus copies associated with samples from scale 0 was significantly lower (564) than other scales (Fig. 5). However, negative controls (DNA of healthy tomato developed by tissue culture) did not show any virus with the Ct value of 37.414 (Fig. 4 and Fig. 5). The Ct values were proportional to the log of starting quantity of template DNA and SYBR Green PCR efficiencies for the TYLCV-OM assays was 99.5% (slope: -3.884). The average value of virus detected for scale 0-3 ranged from 564-2.88 x109 with the Ct values ranged from 37-8, respectively.

Table 2: PCR-based detection of TYLCV-OM in tomato plants differing in the severity of TYLCV

AVRDC severity Scale###Sample size###PCR for TYLCV-OM

There was a positive correlation between disease severity scale and virus titer. Significant differences were found for viral accumulation between the different scales (Fig. 4). The field samples of scale 0 did not exhibit any visual symptoms (Fig. 1). Although conventional PCR fails to detect any virus in those sample but qPCR showed appreciable amount of viral DNA, yet 1000 fold <scale 1 (Fig. 5). These results showed that apparently healthy field samples had enough virus inoculum for the white flies to take up. The difference in viral copies of plants from scale 1 and 2 was relatively less as compared to other scales. The highest amount of virus titer was found in scale 3 with values reaching up to 2.88 x 109 (Fig. 5).

TYLCD has become the major limiting factor for tomato production in many warm and temperate regions worldwide by developing new recombinants. According to ICTV, TYLCD is a disease complex comprised of several different virus isolates/species which belong to the genus Begomovirus. Among various isolates responsible to TYLCD complex, currently TYLCV isolate has been reported as the most important Begomovirus species infecting Solanaceous and other vegetable crops in Europe and the Mediterranean Basin.

It is also believed that TYLCV has emerged somewhere in the Middle East and extends throughout the Mediterranean basin, Asia, Africa and America (Navas-Castillo et al., 1999 Accotto et al., 2003 Papayiannis et al., 2010 Davino et al., 2012 Khan et al., 2014).

The recent advancement of molecular diagnostic systems during the past few years has enabled rapid diagnosis of TYLCD in field. Similarly several conventional PCR and qPCR-based techniques have improved remarkably for the detection of various virus species (Accotto et al., 2000 Gorsane et al., 2005 Davino et al., 2009). The development of fluorescent methods for PCR and also the instruments like real-time which can monitor the amplification process is considered as a significant improvement in molecular biology. qPCR have been extensively used in various branches of life sciences during the past few years, which includes infectious disease detection in humans (Enbom et al., 2001), animals (Brinkhof et al., 2008) and plants (Boonham et al., 2004), differentiation of invertebrate biotypes within a species (Papayiannis et al., 2009) and mutation scanning (Wittwer et al., 2003).

In the present study a qPCR assay based on SYBR

Green chemistry was developed for the detection and quantification of TYLCV-OM and successfully applied on TYLCD affected tomato plants from a field showing different severity scales. The data presented here showed the sensitive and specific detection/amplification of TYLCV-OM and there was a positive correlation between virus titer and symptom severity. During the development of this assay, it was ensured that no cross-reaction occurred between different TYLCV species isolated from Oman. The developed assay was also compared with conventional PCR for its sensitivity. Results showed that qPCR assay developed in this study can detect virus down to a dilution of 1:10-8 1000 times more sensitive than conventional PCR. Our results have shown that plants from symptom severity scale 0, which were asymptomatic, carry small amount of the virus. Conventional PCR failed to detect virus however, qPCR was sensitive enough to detect such low virus copies in plants showing a symptom severity scale of 0.

These results are highly significant and indicate that TYLCD is present in the filed in apparently healthy plants. These plants though remain symptomless but can serve as a reservoir of viruses where their vector can carry and transmit these viruses to other hosts. The greater specificity and sensitivity of developed qPCR assay can thus be used in such samples/hosts where conventional PCR fail to detect virus as shown in this study.

In the present study, we have developed a specific qPCR method for detection/quantification of TYLCV - OM and the relative amount of virus levels in field infected plants has been evaluated. The developed assay can also be used for other related hosts of TYLCV -OM from Solanaceae family like pepper, chili, tobacco and alternative hosts like weeds. The practical use of hazardous compounds like ethidium bromide for the pre - and post-amplification detection by gel electrophoresis could be minimized by using the assay developed in this study. Moreover, this method can be used to detect and quantify virus in those hosts where virus titer is lower than the detection limit of conventional methods. Therefore, this assay can be used in breeding programs for the identification of sources of resistant and for epidemiological surveys to monitor viral spread and population.

It is speculated that all worldwide TYLCV isolates which share similar or identical nucleotide mismatches could be accurately detected and quantified by the developed TYLCV qPCR assay.

Authors would like to acknowledge Sultan Qaboos University for the financial support of this study.

Accotto, G.P., M. Bragaloni, D. Luison, S. Davino and M. Davino, 2003. First report of Tomato yellow leaf curl virus (TYLCV) in Italy. Plant Pathol., 52: 799

Accotto, G.P., J. Navas-Castillo, E. Noris, E. Moriones and D. Louro, 2000. Typing of tomato yellow leaf curl viruses in Europe. Eur. J. Plant Pathol., 106: 179-186

Boonham, N., L. Gonzalez Perez, M.S. Mendez, E. Lilia Peralta, A. Blockley, K. Walsh, I. Barker and R.A. Mumford, 2004. Development of a real-time RT-PCR assay for the detection of Potato spindle tuber viroid. Ҷ. Вирол. Methods, 116: 139-146

Brinkhof, J.M.A., C. van Maanen, R. Wigger, K. Peterson and D.J. Houwers, 2008. Specific detection of small ruminant lentiviral nucleic acid sequences located in the proviral long terminal repeat and leader-gag regions using real-time polymerase chain reaction. Ҷ. Вирол. Methods, 147: 338-344

Cohen, S. and I. Harpaz, 1964. Periodic, rather than continual acquisition of a new tomato virus by its vector, the tobacco whitefly (Bemisia tabaci Gennadius). Энтомол. Exp. Appl., 7: 155-166

Czosnek, H. and H. Laterrot, 1997. A worldwide survey of tomato yellow leaf curl viruses. Arch. Virol., 142: 1391-1406

Davino, S., G.P. Accotto, V. Masenga, L. Torta and M. Davino, 2009. Basil (Ocimum basilicum), a new host of Pepino mosaic virus. Plant Pathol., 58: 407

Davino, S., M. Davino and G.P. Accotto, 2008. A single-tube PCR assay for detecting viruses and their recombinants that cause tomato yellow leaf curl disease in the Mediterranean basin. Ҷ. Вирол. Methods, 147: 93-98

Davino, S., L. Miozzi, S. Panno, L. Rubio, M. Davino and G.P. Accotto, 2012. Recombination profiles between Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in laboratory and field conditions: Evolutionary and taxonomic implications. J. Gen. Virol., 93: 2712-2717

Doyle, J.J. and J.L. Doyle, 1987. A rapid DNA isolation procedure for small amount of fresh leaf tissue. Phytochem. Bull., 19: 11-15

Enbom, M., A. Strand, K.I. Falk and A. Linde, 2001. Detection of epstein- barr virus, but not human herpesvirus 8, DNA in cervical secretions from Swedish women by real-time polymerase chain reaction. Ҷинсӣ. Transmitted Dis., 28: 300-306

Fauquet, C.M., R.W. Briddon, J.K. Brown, E. Moriones, J. Stanley, M. Zerbini and X. Zhou, 2008. Geminivirus strain demarcation and nomenclature. Arch. Virol., 153: 783-821

Fukuta, S., T. Iida, Y. Mizukami, A. Ishida, J. Ueda, M. Kanbe and Y. Ishimoto, 2003. Detection of Japanese yam mosaic virus by RT- LAMP. Arch. Virol., 148: 1713-1720

Gorsane, F., S. Gharsallah-Chouchene, M.K. Nakhla, I. Fekih-Hassan, D.P. Maxwell, M. Marrakchi and H. Fakhfakh, 2005. Simultaneous and rapid differentiation of members of the tomato yellow leaf curl virus complex by multiplex PCR. J. Plant Pathol., 87: 43-48

Huang, S.K., H.Q. Xiao, J. Kleine-Tebbe, G. Paciotti, D.G. Marsh, L.M. Lichtenstein and M.C. Liu, 1995a. IL-13 expression at the sites of allergen challenge in patients with asthma. J. Immunol., 155: 2688-2694

Huang, S.K., M. Yi, E. Palmer and D.G. Marsh, 1995b. A dominant T cell receptor b-chain in response to a short ragweed allergen, Amb a 5. J. Immunol., 154: 6157-6162

Khan, A.J., S. Mansoor and R.W. Briddon, 2014. Oman: A case for a sink of begomoviruses of geographically diverse origins. Trends Plant Sci., 19: 67-70

Lapidot, M. and M. Friedmann, 2002. Breeding for resistance to whitefly-transmitted geminiviruses. Анн. Апп. Biol., 140: 109-127

Lapidot, M., M. Friedmann, O. Lachman, A. Yehezkel, S. Nahon, S. Cohen and M. Pilowsky, 1997. Comparison of resistance level to tomato yellow leaf curl virus among commercial cultivars and breeding lines. Plant Dis., 81: 1425-1428

Martinez-Culebras, P.V., I. Font and C. Jorda, 2001. A rapid PCR method to discriminate between Tomato yellow leaf curl virus isolates. Анн. Апп. Biol., 139: 251-257

Mason, G., P. Caciagli, G.P. Accotto and E. Noris, 2008. Real-time PCR for the quantitation of Tomato yellow leaf curl Sardinia virus in tomato plants and in Bemisia tabaci. Ҷ. Вирол. Methods, 147: 282-289

Moriones, E. and J. Navas-Castillo, 2000. Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Res., 71: 123-134

Mullis, K.B., 1990. The unusual origin of the polymerase chain reaction. Sci. American, 262: 56-65

Mullis, K.B. and F.A. Faloona, 1987. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. MethodsEnzymol., 155:335-350

Navas-Castillo, J., S. Sanchez-Campos, J.A. Diaz, E. Saez-Alonso and E. Moriones, 1999. Tomato yellow leaf curl virus-is causes a novel disease of common bean and severe epidemics in tomato in Spain. Plant Dis., 83: 29-32

Papayiannis, L.C., J.K. Brown, N.A. Seraphides, M. Hadjistylli, N. Ioannou and N.I. Katis, 2009. A real-time PCR assay to differentiate the B and Q biotypes of the Bemisia tabaci complex in Cyprus. Барзагов Энтомол. Res., 99: 573-582

Papayiannis, L.C., T.A. Iacovides, N.I. Katis and J.K. Brown, 2010. Differentiation of Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus using real-time TaqMan(r) PCR. Ҷ. Вирол. Methods, 165: 238-245

Pico, B., M.J. Diez and F. Nuez, 1999. Improved diagnostic techniques for tomato yellow leaf curl virus in tomato breeding programs. Plant Dis., 83: 1006-1012

Tan, X., X. Sun, F.X. Gonzalez-Crussi, F. Gonzalez-Crussi and W. Hsueh, 1994. PAF and TNF increase the precursor of NF-kappa B p50 mRNA in mouse intestine: quantitative analysis by competitive PCR. Lipids Lipid Metabol., 1215: 157-162

Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin and D.G. Higgins, 1997. The CLUSTAL X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res., 25: 4876-4882

Wittwer, C.T., G.H. Reed, C.N. Gundry, J.G. Vandersteen and R.J. Pryor, 2003. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin. Chem., 49: 853-860

Zakay, Y., N. Navot, M. Zeidan, N. Kedar, H. Rabinowitch, H. Czosnek and D. Zamir, 1991. Screening Lycopersicon accessions for resistance to tomato yellow leaf curl siriv: prevecce of s iral leA acd vyaptoa deselopaect. Plant Dis., 75: 279-281

Zhengxing, L., 1999. Screening for Resistance to Tomato Yellow Leaf Curl Virus, pp: 1-6. Aviac Regiocal Cecter, AVRDC, Shanhua, Taiwan