Маълумот

Агар ҳангоми тарҷума як кислотаи аминокислота мавҷуд набошад, маҳз чӣ мешавад?

Агар ҳангоми тарҷума як кислотаи аминокислота мавҷуд набошад, маҳз чӣ мешавад?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Биёед бигӯем, ки ҳуҷайра мехоҳад сафедаи мушаххасе созад. Транскрипсияи гени мувофиқ анҷом дода мешавад ва mRNA сохта мешавад. mRNA ба рибосома пайваст мешавад ва тарҷума ба таври "муқаррарӣ" оғоз мешавад.

Агар кислотаи аминокислотаи дар сафеда мавҷуд набошад, воқеан чӣ рӯй медиҳад? Ман медонам, ки сафеда дуруст тавлид намешавад, аммо ман мехоҳам дақиқ донам, ки бо рибосома ва mRNA чӣ мешавад. Оё онҳо нобуд шудаанд? Оё онҳо танҳо ҷудо шудаанд? Инро кӣ танзим мекунад?


Дуруст нест, ки антикодони tRNA-и заряднашуда наметавонад ба mRNA пайваст шавад.

Бактерияҳо механизме доранд, ки номида мешаванд вокуниши сахт. Ин посух мураккаб аст, дар ин ҷо шарҳи кӯтоҳтар ва соддатар оварда шудааст. Маълумоти бештарро дар саҳифаҳои Википедиа, ки дар матн пайванданд, пайдо кардан мумкин аст.

Агар ҳангоми тарҷума як кислотаи аминокислота мавҷуд набошад, тРНК -и пурнашуда дар рибосома мепайвандад, ки боиси фаъол шудани фермент RelA (дар E. coli), ки бо зербахши 50S -и рибосома алоқаманд аст, синтези сигнали (p) ppGpp -ро ба вуҷуд меорад. Блокҳои тарҷума ва (p)ppGpp бо зербанди β-и RNApol мутақобила мекунанд, ки боиси:

  1. камшавии наздикии он ба омили транскрипсияи σ70 ва аз ин рӯ коҳиш додани транскрипсияи генҳои rRNA;
  2. афзоиши наздикии он ба σS ва σN, омилҳои транскриптӣ, мутаносибан, барои мутобиқшавӣ дар марҳилаи статсарӣ ва набудани N заруранд. Инчунин биосинтези аминокислотаҳо зиёд мешавад.

Пас аз барқарор шудани вазъият, фермент SpoT (coli) гидролиз мекунад (p)ppGpp.


Бояд бидонед: аминоасил-тРНК ба mRNA мепайвандад, он на танҳо т-РНК…

Ҳамин тавр, агар аминокислотаҳо вуҷуд надошта бошанд, аминокислотаҳо-тРНК-и он аминокислотаҳо вуҷуд надоранд... бинобар ин, агар аминоасил-тРНК вуҷуд надошта бошад, антикодони тРНК бо мРНК пайванде ба вуҷуд намеорад, аз ин рӯ истеҳсоли сафеда қатъ мешавад (то даме ки аминокислотаи аминокислотаҳо истеҳсол карда мешавад).

Агар протеин дар муддати тӯлонӣ ташаккул наёбад, сафедаи бармаҳал худро пӯшида мешиканад. Сипас як молекула (масалан: ubiquitin барои баъзе намудҳои бактерияҳо) ба ин сафедаи бармаҳал пайваст мешавад ва онро барои таназзул қайд мекунад.

Аммо ҳанӯз ҳам имкони истеҳсоли сафеда бо мутатсияҳои ночиз вуҷуд дорад.

Мутатсия: tRNA бо як антикодон ва аминокислотаҳои гуногун дар сурати мавҷуд набудани аминоасил-tRNA дуруст ба макони А-и рибосома метавонад ба осонӣ пайваст шавад, бинобар ин дар ин ҳолат истеҳсоли сафеда қатъ намешавад, аммо сафеда бо аминокислотаҳои гуногун мутация дорад. .


Агар ҳангоми тарҷума як кислотаи аминокислота мавҷуд набошад, маҳз чӣ мешавад? - Биология

Расми 1. Банди пептидӣ охири карбоксилии як кислотаи аминокислотаро бо охири аминокислотаи дигар пайваст мекунад ва як молекулаи обро хориҷ мекунад. Барои содда кардани ин тасвир, танҳо гурӯҳҳои функсионалии дар пайванди пептидӣ иштирокдошта нишон дода шудаанд. Нишондиҳандаҳои R ва R 'ба боқимондаи ҳар як сохтори аминокислотаҳо ишора мекунанд.

Раванди тарҷума ё синтези сафедаҳо рамзгузории паёми mRNA ба маҳсулоти полипептидро дар бар мегирад. Кислотаҳои аминокислотаҳо тавассути пайвандҳои пептидӣ ба таври ковалентӣ пайваст мешаванд. Ҳар як аминокислотаи аминокислота як гурӯҳи аминокислотаҳо дорад (NH2) ва гурӯҳи карбоксил (COOH). Полипептидҳо вақте ба вуҷуд меоянд, ки гурӯҳи аминокислотаҳои як аминокислота як пайванди амид (яъне пептид) бо гурӯҳи карбоксилии аминокислотаи дигарро ташкил медиҳанд (Расми 1).

Ин реаксия тавассути рибосомаҳо катализ мешавад ва як молекулаи обро тавлид мекунад.


Интиқоли RNA

РНК -и интиқол дар синтез ва тарҷумаи сафедаҳо нақши бузург дорад. Вазифаи он тарҷумаи паём дар пайдарпаии нуклеотидҳои mRNA ба пайдарпаии мушаххаси аминокислотаҳо мебошад. Ин пайдарпайҳо бо ҳам пайваст шуда, сафеда ташкил мекунанд. РНК-и интиқол ба баргеи беда бо се ҳалқа монанд аст. Он дар як тараф макони пайвастшавии аминокислотаҳо ва як бахши махсус дар ҳалқаи миёна дорад, ки макони антикодон номида мешавад. Антикодон як минтақаи мушаххасро дар mRNA, ки кодон ном дорад, эътироф мекунад.


Дароз кардан

Рибосома дорад ду макони ҳатмии tRNA макони P, ки занҷири ептидро нигоҳ медорад ва макони А, ки tRNA-ро қабул мекунад.

Дар ҳоле ки метионин-тРНК макони Р-ро ишғол мекунад, аминоксил-тРНК, ки ба кодони навбатӣ мукаммал аст, бо истифода аз энергияе, ки аз гидролизи GTP ҳосил мешавад, ба сайти А пайваст мешавад.

Метионин аз сайти Р ба макони А мегузарад, то ба кислотаи нави аминокислота пайваст шавад ва ҳамин тавр афзоиши пептид оғоз ёфт. Молекулаи tRNA дар макони Р дигар аминокислотаи пайвастшуда надорад ва аз ин рӯ рибосомаро тарк мекунад.

Пас рибосома интиқол медиҳад дар баробари молекулаи mRNA ба кодони навбатӣ, боз бо истифода аз энергияе, ки аз гидролизи GTP ҳосил мешавад. Ҳоло, пептиди афзоянда дар макони P ҷойгир аст ва макони А барои пайваст кардани аминоасил-tRNA-и навбатӣ кушода аст ва давра идома дорад. Занҷираи полипептид дар самти терминали N (метионин) то терминали С (кислотаи аминокислотаи ниҳоӣ) сохта шудааст.

Расми 4 – Дарозии занҷири полипептидҳо


РНК бар зидди ДНК

Омехтани РНК бо ДНК ҷолиб аст, аммо онҳо хеле гуногунанд ва фаҳмидани ин фарқиятҳо муҳим аст. Ҳардуи онҳо аз нуклеотидҳо иборатанд, ки воҳидҳои асосии кислотаҳои нуклеинӣ мебошанд (ба монанди ДНК ва РНК). Ин нуклеотидҳо як гурӯҳи фосфат, як пойгоҳи нитрогенӣ ва рибозаи қанди 5 карбониро дар бар мегиранд.

Аммо, ба ҷои рибозаи ДНК, РНК дезоксирибозаро истифода мебарад, ки шакари дигар дорад. Инчунин, РНК аксар вақт як ришта аст, дар ҳоле ки ДНК маъмулан дуқатор аст. Ниҳоят, ДНК тимин дорад, дар ҳоле ки РНК ба ҷои урацил истифода мебарад.


Биология 171

Дар охири ин бахш шумо метавонед корҳои зеринро иҷро кунед:

  • Марҳилаҳои гуногуни синтези сафедаҳоро тавсиф кунед
  • Нақши рибосомаҳоро дар синтези сафедаҳо муҳокима кунед

Синтези сафедаҳо нисбат ба дигар равандҳои мубодилаи моддаҳо бештар энергияи ҳуҷайраро истеъмол мекунад. Дар навбати худ, сафедаҳо нисбат ба дигар ҷузъҳои организмҳои зинда (ба истиснои об) вазни зиёдтар доранд ва сафедаҳо қариб ҳар як вазифаи як ҳуҷайраро иҷро мекунанд. Раванди тарҷума ё синтези сафедаҳо рамзгузории паёми mRNA ба маҳсулоти полипептидро дар бар мегирад. Кислотаҳои аминокислотаҳо бо пайванди пайвандҳои пептидҳо дар дарозии тақрибан аз 50 то зиёда аз 1000 пасмондаҳои аминокислотаҳо бо ковалент пайваст карда мешаванд. Ҳар як аминокислотаи аминокислота як гурӯҳи аминокислотаҳо дорад (NH2) ва гурӯҳи карбоксил (COOH). Полипептидҳо вақте ба вуҷуд меоянд, ки гурӯҳи аминокислотаҳои як аминокислота бо гурӯҳи карбоксили аминокислотаи дигар пайванди амидӣ (яъне пептид) ба вуҷуд меорад ((Расм)). Ин реаксия тавассути рибосомаҳо катализ мешавад ва як молекулаи обро тавлид мекунад.

Мошини синтези сафедаҳо

Илова ба қолаби mRNA, бисёр молекулаҳо ва макромолекулаҳо ба раванди тарҷума мусоидат мекунанд. Таркиби ҳар як ҷузъ метавонад аз рӯи намудҳо фарқ кунад, масалан, рибосомаҳо метавонанд вобаста ба организм аз рақамҳои гуногуни рРНК ва полипептидҳо иборат бошанд. Аммо, сохторҳо ва вазифаҳои умумии дастгоҳи синтези сафедаҳоро аз бактерияҳо то ҳуҷайраҳои инсон қиёс кардан мумкин аст. Тарҷума вуруди як қолаби mRNA, рибосомаҳо, tRNAs ва омилҳои гуногуни ферментативиро талаб мекунад. (Эзоҳ: Рибосомаро метавон ҳамчун фермент тасаввур кард, ки маконҳои пайвастагии аминокислотаҳо аз ҷониби mRNA муайян карда шудаанд.)

Ба воситаи Семинари ДНК клик кунед: Синтези сафеда (саҳифаи веб) барои дидани синтези сафеда дар амал.

Рибосомаҳо

Ҳатто пеш аз тарҷумаи mRNA, ҳуҷайра бояд барои сохтани ҳар як рибосомаи худ энергия сарф кунад. Дар E. coli, дар ҳар лаҳза дар ҳар як ҳуҷайра аз 10,000 то 70,000 рибосома мавҷуд аст. Рибосома макромолекулаи мураккабест, ки аз рРНКҳои сохторӣ ва каталитикӣ ва бисёр полипептидҳои алоҳида иборат аст. Дар эукариотҳо, нуклеолус барои синтез ва ҷамъшавии rRNA -ҳо комилан махсус аст.

Рибосомаҳо дар цитоплазмаи прокариотҳо ва дар ситоплазма ва ретикулуми эндоплазмавии эукариотҳо мавҷуданд. Митохондрия ва хлоропластҳо инчунин дар матритса ва строма рибосомаҳои худро доранд, ки нисбат ба рибосомаҳои берун аз мембранаҳои берунии онҳо дар цитоплазма ба рибосомаҳои прокариотӣ (ва ҳассосияти шабеҳи доруҳо) шабеҳтаранд. Рибосомаҳо вақте ки онҳо сафедаҳоро синтез намекунанд ва ба ҷузъҳои хурду калон тақсим мешаванд ва ҳангоми оғози тарҷума аз нав пайваст мешаванд. Дар E. coli, зербахши хурд ҳамчун 30S тавсиф карда мешавад ва зербахши калон 50S, ба маблағи умумии 70S (хотиррасон кунед, ки воҳидҳои Сведберг иловагӣ нестанд). Рибосомаҳои ширхӯрон як зербахши хурди 40S ва як зербахши калони 60S, ҳамагӣ 80S доранд. Зершӯъбаи хурд барои пайваст кардани қолаби mRNA масъул аст, дар ҳоле ки зербахши калон tRNA-ро пайдарпай мепайвандад. Ҳар як молекулаи mRNA аз ҷониби бисёр рибосомаҳо тарҷума карда мешавад, ки ҳама протеинро дар як самт синтез мекунанд: хондани mRNA аз 5 ′ то 3 ′ ва синтез кардани полипептид аз терминали N то терминали С. Сохтори пурраи mRNA/поли-рибосомаро полисома меноманд.

ТРНК

ТРНКҳо молекулаҳои сохтории РНК мебошанд, ки аз генҳо тавассути РНК полимеразаи III транскрипсия карда шудаанд. Вобаста аз намудҳо, дар цитоплазма аз 40 то 60 намуди тРНК мавҷуд аст. РНК-ҳои интиқол ҳамчун молекулаҳои адаптер хизмат мекунанд. Ҳар як tRNA як кислотаи аминокислота дорад ва як ё якчанд кодрҳои mRNA -ро эътироф мекунад, ки тартиби аминокислотаҳоро дар сафеда муайян мекунанд. Аминоацил-тРНКҳо ба рибосома пайваст мешаванд ва ба занҷири полипептид кислотаи аминокислотаи мувофиқро илова мекунанд. Аз ин рӯ, tRNA молекулаҳоест, ки воқеан забони РНК -ро ба забони сафедаҳо "тарҷума" мекунанд.

Аз 64 кодонҳои имконпазири mRNA - ё омезиши сегонаи A, U, G ва C - се қатъшавии синтези сафедаҳоро ва 61 илова кардани аминокислотаҳоро ба занҷири полипептидҳо муайян мекунанд. Аз ин 61, як кодон (AUG) низ оғози тарҷумаро рамзгузорӣ мекунад. Ҳар як антикодони tRNA метавонад бо як ё якчанд кодонҳои mRNA барои кислотаи аминокислотаи худ ҷуфт кунад. Масалан, агар пайдарпаии CUA дар қолаби mRNA дар чаҳорчӯбаи дурусти хониш рух дода бошад, он як тРНК -и лейцинро мебандад, ки пайдарпаии иловагии GAU -ро ифода мекунад. Қобилияти баъзе тРНКҳо барои мувофиқ кардани зиёда аз як кодон он чизест, ки ба коди генетикӣ сохтори блоки он медиҳад.

Ҳамчун молекулаҳои адаптерии тарҷума, тааҷҷубовар аст, ки tRNA -ҳо метавонанд ба чунин як бастаи хурд хусусияти зиёд дошта бошанд. Ба назар гиред, ки tRNA-ҳо бояд бо се омил ҳамкорӣ кунанд: 1) онҳо бояд аз ҷониби аминоасилсинтетазаи дуруст эътироф карда шаванд (ба поён нигаред) 2) онҳо бояд аз ҷониби рибосомаҳо эътироф карда шаванд ва 3) онҳо бояд ба пайдарпаии дурусти mRNA пайваст шаванд.

Синтетазаҳои аминоксил tRNA

Раванди синтези пеш аз тРНК аз ҷониби РНК полимеразаи III танҳо як қисми РНК-и молекулаи адаптерро ба вуҷуд меорад. Пас аз коркарди tRNA ва ба цитоплазма содир кардани кислотаи аминокислотаи мувофиқ бояд дертар илова карда шавад. Тавассути раванди "пуркунии" tRNA, ҳар як молекулаи тРНК бо яке аз гурӯҳи ферментҳо бо номи синтетазаҳои аминоакил tRNA бо кислотаи аминокислотаи худ пайваст карда мешавад. Ҳадди ақал як намуди синтетазаи аминоасил тРНК барои ҳар як аз 20 аминокислотаҳо мавҷуд аст, шумораи дақиқи синтетазаҳои аминоасил тРНК вобаста ба намудҳо фарқ мекунанд. Ин ферментҳо аввал ATP-ро мепайванданд ва гидролиз мекунанд, то як пайвастагии энергияи баланд байни як кислотаи аминокислота ва аденозин монофосфат (AMP) як молекулаи пирофосфат дар ин реаксия хориҷ карда шаванд. Пас аз он кислотаи аминокислотаи фаъолшуда ба tRNA интиқол дода мешавад ва AMP озод карда мешавад. Истилоҳи “боркунӣ ” мувофиқ аст, зеро пайванди энергияи баланд, ки ба тРНК-и аминокислота мепайвандад, баъдтар барои ташаккули пайванди пептидҳо истифода мешавад. Ҳар як тРНК барои аминокислотаи он номгузорӣ шудааст.

Механизми синтези сафедаҳо

Мисли синтези mRNA, синтези сафедаҳоро ба се марҳила тақсим кардан мумкин аст: оғоз, дароз кардан ва хотима додан. Раванди тарҷума дар прокариотҳо ва эукариотҳо шабеҳ аст. Дар ин ҷо мо мефаҳмем, ки тарҷума дар куҷо пайдо мешавад E. coli, прокариоти намояндагӣ ва ҳама гуна фарқияти байни тарҷумаи прокариотӣ ва эукариотро муайян кунед.

Оғози тарҷума

Синтези сафедаҳо бо ташаккули комплекси ибтидоӣ оғоз меёбад. Дар E. coli, ин маҷмӯа рибосомаи хурди 30S, қолаби mRNA, се омили оғоз (IFs IF-1, IF-2 ва IF-3) ва tRNA ташаббускори махсусро, ки tRNA Metf ном дорад, дар бар мегирад.

Дар E. coli mRNA, пайдарпаии болооби аввалин кодони AUG, ки онро пайдарпаии Шин-Далгарно (AGGAGG) меноманд, бо молекулаҳои рРНК, ки рибосомаро ташкил медиҳанд, ҳамкорӣ мекунад. Ин ҳамкорӣ зербахши рибосомавии 30S -ро дар ҷои дуруст дар қолаби mRNA лангар мебандад. Гуанозинтрифосфат (GTP), ки як трифосфати пурин нуклеотид аст, дар вақти тарҷума ҳамчун манбаи энергия амал мекунад - ҳам дар оғози дарозшавӣ ва ҳам ҳангоми интиқоли рибосома. Пайвастагии mRNA ба рибосомаи 30S инчунин IF-III-ро талаб мекунад.

Сипас tRNA -и ташаббускор бо рамзи ибтидоии AUG (ё кам, GUG) ҳамкорӣ мекунад. Ин тРНК метионини аминокислотаро мебардорад, ки пас аз пайваст шуданаш ба тРНК формил карда мешавад. Формилизатсия як пайванди пептидӣ байни гурӯҳи карбоксилҳои формил ва гурӯҳи аминокислотаи метионинро ба вуҷуд меорад. Пайвастагии fMet-tRNA Metf тавассути омили ибтидоии IF-2 миёнаравӣ карда мешавад. FMet ҳар як занҷири полипептидро, ки аз ҷониби синтез карда мешавад, оғоз мекунад E. coli, аммо он одатан пас аз анҷоми тарҷума хориҷ карда мешавад. Ҳангоме ки ҳангоми дарозшавии тарҷума AUG дар дохили чорчӯба дучор мешавад, метионини ғайрирасмӣ аз ҷониби Met-tRNA Met муқаррар карда мешавад. Пас аз ташаккули маҷмӯи ташаббус, зербахши рибосомаи 30S бо зербахши 50S ҳамроҳ шуда, маҷмӯи тарҷумаро ташкил медиҳад. Дар эукариотҳо комплекси шабеҳи ибтидоӣ ба вуҷуд меояд, ки аз mRNA, зербахши хурди 40S рибосомӣ, IF-ҳои эукариотӣ ва трифосфатҳои нуклеозид (GTP ва ATP) иборат аст. Метионин дар ташаббускори тРНК, ки Met-tRNA ном дорадi, формат карда нашудааст. Аммо, Met-tRNAi Он аз дигар Met-tRNA-ҳо бо он фарқ мекунад, ки он метавонад IF-ҳоро пайваст кунад.

Ба ҷои гузоштан дар пайдарпаии Shine-Dalgarno, комплекси ибтидоии эукариотӣ сарпӯши 7-метилгуанозинро дар охири 5′-и mRNA эътироф мекунад. Протеини ҳатмӣ (CBP) ва якчанд IF-ҳои дигар ба ҳаракати рибосома то ҳадди ақалли 5 ′ мусоидат мекунанд. Як бор дар ҳадди аққал, маҷмӯи ташаббус дар баробари mRNA дар самти 5 ′ то 3 ′ пайгирӣ карда, кодони оғози AUG -ро меҷӯяд. Бисёре аз mRNA-ҳои эукариотӣ аз AUG аввал тарҷума карда мешаванд, аммо ин на ҳамеша чунин аст. Мувофиқи қоидаҳои Козак, нуклеотидҳо дар атрофи AUG нишон медиҳанд, ки оё ин кодони ибтидои дуруст аст ё не. Қоидаҳои Козак изҳор мекунанд, ки пайдарпаии консенсуси зерин бояд дар атрофи AUG генҳои устухонҳо пайдо шаванд: 5 & # 8242-gccRccAUGG-3 & # 8242. R (барои пурин) маконеро нишон медиҳад, ки метавонад A ё G бошад, аммо C ё U буда наметавонад. Аслан, пайдарпаӣ ба ин ризо наздиктар бошад, самаранокии тарҷума баландтар мешавад.

Пас аз муайян кардани AUG-и мувофиқ, дигар сафедаҳо ва CBP ҷудо мешаванд ва зербанди 60S ба маҷмӯи Met-tRNA пайваст мешавадi, mRNA ва зербахши 40S. Ин қадам оғози тарҷумаро дар эукариотҳо ба анҷом мерасонад.

Тарҷума, дароз кардан ва хотима додан

Дар прокариотҳо ва эукариотҳо асосҳои дарозшавӣ якхелаанд, аз ин рӯ мо дарозкуниро аз нуқтаи назари E. coli. Вақте ки комплекси тарҷума ба вуҷуд меояд, минтақаи пайвасткунандаи tRNA аз рибосома аз се қисм иборат аст. Сайти А (аминоасил) tRNA-ҳои зарядноки воридшавандаи аминоасилро мепайвандад. Сайти P (пептидил) тРНКҳои заряднокро, ки аминокислотаҳоро мебандад, мепайвандад, ки бо занҷири полипептиди афзоянда пайвандҳои пептидӣ ба вуҷуд овардаанд, аммо то ҳол аз тРНК -и мувофиқи худ ҷудо нашудаанд. Сайти E (баромадан) тРНКҳои ҷудошударо мебарорад, то онҳо бо кислотаҳои аминокислотаи озод пур карда шаванд. Аммо, метионил-тРНК-и ташаббускор макони Р-ро дар оғози марҳилаи дарозшавии тарҷума ҳам дар прокариотҳо ва ҳам эукариотҳо ишғол мекунад.

Ҳангоми дарозшавии тарҷума, қолаби mRNA хусусияти ҳатмии tRNA-ро таъмин мекунад. Ҳангоме ки рибосома дар баробари mRNA ҳаракат мекунад, ҳар як кодон mRNA ба қайд гирифта мешавад ва пайвастагии мушаххас бо антикодони зарядноки tRNA таъмин карда мешавад. Агар mRNA дар комплекси дарозшавӣ мавҷуд намебуд, рибосома тРНК-ро ба таври ғайримустақим ва тасодуфӣ мепайвандад (?).

Элонгатсия бо тРНКҳои заряддор пайдарпай вориди рибосома мешавад ва вақте ки ҳар як кислотаи аминокислотаи нав ба занҷири полипептид илова карда мешавад. Ҳаракати tRNA аз сайти А то Р ба E тавассути тағироти конформатсионӣ ба вуҷуд меояд, ки рибосомаро бо се асос дар самти 3 ′ пеш мебаранд. Энергия барои ҳар як қадами рибосома аз ҷониби омилҳои дарозкунӣ, ки GTP -ро гидролиз мекунанд, дода мешавад. Энергияи GTP ҳам барои пайвастани аминоацил-тРНК-и нав ба макони А ва ҳам барои транслокатсияи он ба макони Р пас аз ташаккули пайванди пептид лозим аст. Дар байни гурӯҳи аминокислотаи аминокислотаҳое, ки ба tRNA-и макони A ва сайти гурӯҳи карбоксилии кислотаи аминокислотаи ба t-R-сайти P пайвастшуда пайвандҳои пептидӣ ба вуҷуд меоянд. Ташаккули ҳар як пайванди пептидӣ тавассути пептидил трансфераза, як фермент дар асоси РНК, ки ба зербахши рибосомаи 50S муттаҳид шудааст, катализ мешавад. Энергия барои ҳар як ташаккули пайванди пептидӣ аз пайванди энергияи баланд, ки ҳар як аминокислотаро бо tRNA-и он мепайвандад, гирифта мешавад. Пас аз ташаккули пайванди пептидӣ, tRNA-и маконие, ки ҳоло занҷири пептидҳои афзоянда дорад, ба сайти P мегузарад ва тРНК-и сайти холо ба макони Е ҳаракат мекунад ва аз рибосома хориҷ мешавад ((расм)). Аҷиб, ки E. coli дастгоҳи тарҷума барои илова кардани ҳар як аминокислота ҳамагӣ 0,05 сония вақт мегирад, яъне сафедаи 200 аминокислотаро дар давоми 10 сония тарҷума кардан мумкин аст.

Бисёре аз антибиотикҳо синтези сафедаи бактерияҳоро бозмедоранд. Масалан, тетрациклин макони А-ро дар рибосомаи бактериявӣ маҳкам мекунад ва хлорамфеникол интиқоли пептидилро блок мекунад. Шумо интизор будед, ки ҳар яке аз ин антибиотикҳо ба синтези сафедаҳо чӣ гуна таъсир мерасонад?

Тетрациклин бевосита таъсир мерасонад:

Левомицетикол бевосита таъсир мерасонад:

Қатъи тарҷума вақте рух медиҳад, ки кодони бемаънӣ (UAA, UAG ё UGA) дучор мешавад. Ҳангоми мувофиқат кардан бо сайти A, ин кодонҳои сафсата аз ҷониби онҳо эътироф карда мешаванд омилҳои баровардани сафедаҳо ки ба tRNA -ҳо шабоҳат доранд. Омилҳои озодкунанда дар ҳам прокариотҳо ва ҳам эукариотҳо ба пептидил трансфераза дастур медиҳанд, ки ба охири карбоксилии аминокислотаи P-сайти молекулаи об илова кунанд. Ин реаксия кислотаи аминокислотаи P-ро маҷбур мекунад, ки аз tRNA-и худ ҷудо шавад ва сафедаи нав сохташуда озод карда мешавад. Воҳидҳои хурду калони рибосомӣ аз mRNA ҷудо мешаванд ва аз якдигар қариб фавран ба як маҷмааи дигари оғозёбии тарҷума ҷалб карда мешаванд. Пас аз анҷом ёфтани тарҷумаи бисёр рибосомаҳо, mRNA вайрон мешавад, бинобарин нуклеотидҳоро дар аксуламали дигари транскрипсия дубора истифода бурдан мумкин аст.

Қабати сафедаҳо, тағирот ва ҳадафгузорӣ

Ҳангоми ва баъд аз тарҷума, кислотаҳои аминокислотаҳои инфиродӣ метавонанд аз ҷиҳати кимиёвӣ тағир дода шаванд, пайдарпаии сигналҳо илова карда шаванд ва сафедаи нав дар натиҷаи таъсири мутақобилаи дохили молекулавӣ ба як сохтори возеҳи се андоза "печида" шавад. Пайдарпаии сигнал як пайдарпаии кӯтоҳ дар охири аминокислотаи сафеда мебошад, ки онро ба як қитъаи мушаххаси ҳуҷайра равона мекунад. Ин пайдарпайҳоро метавон ҳамчун "чиптаи қатораи" сафеда ба макони ниҳоии худ баррасӣ кард ва аз ҷониби сафедаҳои шинохти сигнал, ки ҳамчун баранда амал мекунанд, эътироф карда мешаванд. Масалан, истгоҳи мушаххаси пайдарпайии сигнал протеинро ба митохондрия ё хлоропластҳо (дар растаниҳо) равона мекунад. Пас аз расидани сафеда ба макони мобилии худ, пайдарпаии сигнал одатан бурида мешавад.

Бисёре аз сафедаҳо худ ба худ пӯшида мешаванд, аммо баъзе сафедаҳо молекулаҳои ёварро талаб мекунанд парасторон, барои пешгирӣ кардани ҷамъшавии онҳо дар ҷараёни мураккаби печонидашуда. Ҳатто агар протеин аз ҷониби mRNA -и мувофиқи он дуруст муайян карда шуда бошад ҳам, он метавонад шакли комилан корношоям гирад, агар ҳарорати ғайримуқаррарӣ ё рН аз пӯшиши дуруст монеъ шавад.

Хулосаи бахш

Ба бозигарон дар тарҷума қолаби mRNA, рибосомаҳо, tRNAs ва омилҳои гуногуни ферментативӣ дохил мешаванд. Воҳиди хурди рибосомӣ ба қолаби mRNA ё бо пайдарпаии Шин-Далгарно (прокариотҳо) ё ҳадди ақалли 5 ′ (эукариотҳо) пайваст мешавад. Тарҷума аз оғози AUG дар mRNA бо нишон додани метионин оғоз мешавад. Ташаккули пайвандҳои пептидӣ дар байни аминокислотаҳои пайдарпай ба шаблони mRNA бо tRNA-ҳои онҳо мувофиқи коди генетикӣ мувофиқат мекунанд. ТРНКҳои заряднок ба макони рибосомаи А ворид мешаванд ва кислотаҳои аминокислотаи онҳо бо кислотаи аминокислота дар макони Р пайваст мешаванд. Тамоми mRNA дар "қадамҳои" се нуклеотиди рибосома тарҷума мешавад. Вақте ки кодони бемаънӣ дучор мешавад, омили раҳокунанда ҷузъҳоро мепайвандад ва ҷудо мекунад ва сафедаи навро озод мекунад. Пӯшидани сафеда ҳангоми тарҷума ва пас аз тарҷума ба амал меояд.

Пайвастҳои санъат

(Расм) Бисёр антибиотикҳо синтези сафедаи бактерияҳоро бозмедоранд. Масалан, тетрациклин макони А-ро дар рибосомаи бактериявӣ маҳкам мекунад ва хлорамфеникол интиқоли пептидилро блок мекунад. Шумо интизор будед, ки ҳар яке аз ин антибиотикҳо ба синтези сафедаҳо чӣ гуна таъсир мерасонад?

Тетрациклин бевосита таъсир мерасонад:

Хлорамфеникол бевосита таъсир мерасонад

(Расм) Тетрациклин: а Левомицетин: в.

Ҷавоби озод

Тартиби зеринро тарҷума ва тарҷума кунед (риштаи намунавӣ): 5 ′-ATGGCCGGTTATTAAGCA-3 ′

mRNA чунин хоҳад буд: 5′-AUGGCCGGUUAUUAAGCA-3′. Протеин чунин хоҳад буд: MAGY. Гарчанде ки шаш кодон вуҷуд дорад, кодони панҷум ба истгоҳ мувофиқат мекунад, аз ин рӯ кодони шашум тарҷума намешавад.

Фаҳмонед, ки чӣ гуна тағироти ягонаи нуклеотид метавонад ба кори сафедаҳо таъсири хеле гуногун расонад.

Тағироти нуклеотид дар мавқеи сеюми кодонҳо наметавонанд аминокислотаро тағир диҳанд ва ба сафеда ҳеҷ таъсире нахоҳанд дошт. Дигар тағироти нуклеотидҳо, ки аминокислотаҳои муҳимро тағир медиҳанд ё кодонҳои оғоз ё қатъро эҷод мекунанд ё нест мекунанд, ба пайдарпаии аминокислотаҳои сафеда таъсири ҷиддӣ мерасонанд.

Як mRNA -и муқаррарӣ, ки 5 ' -UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3' -ро мехонад, мутацияи воридкунанда дорад, ки пайдарпаиро ба 5 '-UGCCAUGG тағир медиҳадУUAAUAACACAUGAGGCCUGAAC– 3 ’. mRNA-и аслӣ ва mRNA-и мутатсияшударо тарҷума кунед ва фаҳмонед, ки чӣ гуна мутатсияҳои воридшавӣ ба сафедаҳо таъсири назаррас дошта метавонанд. (Маслиҳат: Боварӣ ҳосил кунед, ки сайти оғозро пайдо кунед.)

MRNA аслӣ: 5 ’–UGCC AUG GUA AUA ACA CAU GAG GCC UGA AC– 3’

Тарҷума: Met - Val - Ile - Thr - His - Glu - Ala

mRNA-и мутатсияшуда: 5' -UGCC AUG GУU AAU AAC ACA UGA GGCCUGAAC– 3 '

Тарҷума: Met – Val – Asn – Asn – Thr

Мутацияҳои воридкунӣ метавонанд ба сафедаҳо таъсири назаррас расонанд, зеро онҳо чаҳорчӯбаи хондани кодонҳоро иваз мекунанд. Ин аминокислотаҳоеро, ки аз ҷониби mRNA рамзгузорӣ шудааст, тағир медиҳад ва метавонад ҷойҳои бармаҳал оғоз ё қатъро ҷорӣ кунад.

Луғатнома

Ферменти аминоакил tRNA синтетаза, ки молекулаҳои tRNA -ро бо катализатсия кардани пайванди байни tRNA ва tRNA ташаббускори аминокислотаи tRNA дар прокариотҳо "пур мекунад" дар эукариотҳо, ки онро tRNA меномандi tRNA, ки бо кодони ибтидоӣ ҳамкорӣ мекунад, мустақиман ба макони рибосомаи P мепайвандад ва барои оғоз кардани занҷири полипептидӣ ба метионини махсус пайваст мешавад Қоидаҳои Козак ибтидои дурусти AUG-ро дар mRNA эукариотӣ муайян мекунанд, пайдарпаии консенсуси зерин бояд дар атрофи AUG пайдо шавад: 5 '-GCC (пурин)CCАвгГ.-3 'асосҳои ғафс муҳимтарин фермент дар асоси пептидил трансфераза РНК мебошанд, ки ба зербахши рибосомаҳои 50S дохил карда шудаанд ва ташаккули пайвандҳои пептидҳои молекулаи полисомаи mRNA-ро катализ мекунад, ки ҳамзамон аз ҷониби бисёр рибосомаҳо тарҷума карда мешаванд, ки ҳама дар як самт Shine-Dalgarno ( AGGAGG) тарҷумаи прокариотро тавассути мутақобила бо молекулаҳои rRNA, ки пайдарпаии сигнали 30S-и рибосомаи аминокислотаҳо доранд, оғоз мекунад, ки сафедаро ба як ҷузъи мушаххаси ҳуҷайра равона мекунад, кодони AUG (ё хеле кам, GUG) дар mRNA оғоз меёбад, ки тарҷума ҳамеша метинро муайян мекунад.

Чаҳорчӯбаи хонишро кушоед

Пас аз муайян кардани кодони оғоз, ҳар як гурӯҳи пайдарпайи се ҷуфти асосӣ кодони навбатиро ташкил медиҳанд. Бо ин роҳ мавқеи кодони ибтидоӣ чаҳорчӯбаи хониши кушод ё тартиби кодонҳоро, ки барои ташаккули сафеда хонда мешаванд, муайян мекунад. Дар мисоли зер, вақте ки рибосома дар AUG аввал ҷамъ мешавад, тартиби боқимондаи кодонҳо барои тарҷумаи боқимондаи mRNA муқаррар карда мешавад.


Кодекси генетикӣ ва тарҷумаи аминокислотаҳо

Дар ҷадвали 1 рамзи генетикии кислотаи рибонуклеинӣ (mRNA) нишон дода шудааст, яъне он ҳама 64 комбинатсияи имконпазири кодонҳоро, ки аз се асоси нуклеотидӣ (воҳидҳои три-нуклеотид) иборатанд, нишон медиҳад, ки аминокислотаҳо ҳангоми ҷамъшавии сафедаҳоро муайян мекунанд.

Ҳар як кодони кислотаи дезоксирибонуклеин (ДНК) як кислотаи аминокислотаро муайян мекунад ё ҳар як воҳиди нуклеотидҳо аз фосфат, шакар дезоксирибоза ва яке аз 4 асосҳои нуклеотидҳои нитрогенӣ, аденин (А), гуанин (G), цитозин (C) иборат аст. ) ва тимин (Т). Асосҳо бо пайвандҳои гидроген дар спирали дугонаи ДНК ҷуфт карда мешаванд. mRNA ба ДНК мувофиқат мекунад (яъне пайдарпаии нуклеотидҳо дар ҳарду занҷир якхела аст), ба истиснои он ки дар РНК тимин (Т) бо урацил (U) ва дезоксирибоза бо рибоза иваз карда мешавад.

Раванди тарҷумаи иттилооти генетикӣ ба ҷамъшавии сафеда аввал мРНК-ро талаб мекунад, ки он аз 5' то 3' (махз ба ДНК) хонда мешавад ва сипас интиқоли кислотаи рибонуклеинӣ (tRNA), ки аз 3' то 5' хонда мешавад. tRNA таксиест, ки маълумотро дар бораи рибосома ба занҷири аминокислотаҳо ё полипептид тарҷума мекунад.

Барои mRNA 4 3 = 64 комбинатсияи нуклеотидҳои гуногун бо кодони триплети се нуклеотид имконпазир аст. Ҳама 64 комбинатсияи имконпазир дар ҷадвали 1 нишон дода шудаанд. Аммо на ҳама 64 кодонҳои коди генетикӣ ҳангоми тарҷума як кислотаи аминокислотаи ягонаро муайян мекунанд. Сабаб дар он аст, ки дар одам танҳо 20 аминокислотаҳо (ба истиснои селеноцистеин) дар тарҷума иштирок мекунанд. Аз ин рӯ, як аминокислота метавонад бо зиёда аз як кодон-триплети mRNA рамзгузорӣ карда шавад. Аргинин ва лейцин бо 6 сегона, изолейцин бо 3, метионин ва триптофан бо 1 ва ҳама аминокислотаҳои дигар бо 4 ё 2 кодон рамзгузорӣ шудаанд. Кодонҳои зиёдатӣ одатан дар пойгоҳи 3 -юм фарқ мекунанд. Дар ҷадвали 2 таъиноти баръакси кодон нишон дода шудааст, яъне кадом кодон муайян мекунад, ки кадоме аз 20 кислотаи аминокислотаҳои стандартӣ, ки дар тарҷума иштирок мекунанд.

Ҷадвали 1. Рамзи генетикӣ: кодон mRNA -> аминокислотаҳо

1 -ум
Пойгоҳ
2 -юм
Пойгоҳ
3 -юм
Пойгоҳ
У $ C А. Г.
У Фенилаланин Серин Тирозин Цистеин У
Фенилаланин Серин Тирозин Цистеин $ C
Лейцин Серин Ист Ист А.
Лейцин Серин Ист Триптофан Г.
$ C Лейцин Пролин Гистидин Аргинин У
Лейцин Пролин Гистидин Аргинин $ C
Лейцин Пролин Глутамин Аргинин А.
Лейцин Пролин Глутамин Аргинин Г.
А. Изолейцин Треонин Аспарагин Серин У
Изолейцин Треонин Аспарагин Серин $ C
Изолейцин Треонин Лизин Аргинин А.
Метионин (Оғоз) 1 Треонин Лизин Аргинин Г.
Г. Валин Аланин Аспартат Глицин У
Валин Аланин Аспартат Глицин $ C
Валин Аланин Глутамат Глицин А.
Валин Аланин Глутамат Глицин Г.

Ҷадвали 2. Ҷадвали кодон баръакс: кислотаи аминокислотаҳо -> кодон mRNA

Кислотаи аминокислотаҳо кодонҳои mRNA Кислотаи аминокислотаҳо кодонҳои mRNA
Ала/А. GCU, GCC, GCA, GCG Леу/Л UUA, UUG, CUU, CUC, CUA, CUG
Арг/Р CGU, CGC, CGA, CGG, AGA, AGG Лис/К. ААА, АГА
Асн/Н AAU, AAC Мулоқот/М. АВГ
Асп/Д GAU, GAC Фе/Ф UUU, UUC
Cys/C. UGU, UGC Pro/P CCU, CCC, CCA, CCG
Gln/Q CAA, CAG Сер/С. UCU, UCC, UCA, UCG, AGU, AGC
Glu/E. ГАА, ГАГ Thr/T ACU, ACC, ACA, ACG
Гли/Г. GGU, GGC, GGA, GGG Trp/W UGG
Ӯ/Ҳ CAU, CAC Тир/Й UAU, UAC
Иле/И. AUU, AUC, AUA Вал/В. ГУ, ГУ, ГУА, ГУГ
Оғоз кардан АВГ ИСТ UAG, UGA, UAA

Самти хондани mRNA аз 5 'то 3' аст. tRNA (хондани 3 'то 5') дорои антикодонҳои ба кодонҳо дар mRNA буда, метавонад дар терминали 3 '-и онҳо бо кислотаҳои аминокислотаҳо "заряднок" бошад. Мувофиқи Крик, пайвастшавии ҷуфтҳои асосӣ байни кодони mRNA ва антикодони tRNA танҳо дар пойгоҳи 1 ва 2 сурат мегирад. Пайвастшавӣ дар пойгоҳи 3 -юм (яъне дар охири 5 '-и антикодони tRNA) заифтар аст ва метавонад боиси ҷуфтҳои гуногун гардад. Барои ба амал омадани пайванди байни кодон ва антикодон асосҳо бояд аз мавқеъи худ дар рибосома берун шаванд. Аз ин рӯ, ҷуфтҳои асосиро баъзан ҷуфтҳои волбле меноманд.

Ҷадвали 3 ҷуфтҳои имконпазири ларзишро дар пойгоҳҳои 1, 2 ва 3 нишон медиҳад. Комбинатсияҳои имконпазири ҷуфт дар пойгоҳи 1 ва 2 якхелаанд. Дар пойгоҳи 3-юм (яъне дар охири 3' охири mRNA ва 5' охири tRNA) комбинатсияи ҷуфтҳои имконпазир камтар якранг мебошанд, ки боиси зиёдатӣ дар mRNA мегардад. Дезаминизатсия (бардоштани гурӯҳи аминокислотаҳо NH2) аз аденозин (бо аденин омехта накунед) инозини нуклеотид (I) -ро дар tRNA тавлид мекунад, ки дар mRNA ҷуфтҳои ғайрифаъол бо U, C ё A (аммо на G) тавлид мекунад. Инозин метавонад дар заминаи 3 -юми tRNA пайдо шавад.

Ҷадвали 3. Ҷуфтҳои асосӣ: cRON mRNA -> tRNA anticodon

Ҷадвали 3 ба таври зерин хонда мешавад: барои ҷуфтҳои пойгоҳҳои 1 ва 2 ҷуфтҳои воблӣ беназириро тавре таъмин мекунанд, ки U дар tRNA ҳамеша аз A дар mRNA, A дар tRNA ҳамеша аз U дар mRNA ва ғайра пайдо шавад. ҷуфти 3-юми асос коди генетикӣ зиёдатист, ки U дар tRNA метавонад аз A ё G дар mRNA, G дар tRNA метавонад аз U ё C дар mRNA ва I дар tRNA аз U, C ё A дар барояд. mRNA. Танҳо A ва C дар ҷои 3 -юми tRNA ба таври возеҳ ба U ва G дар ҷои сеюм дар mRNA таъин карда мешаванд.

Ба шарофати ин сохтори комбинатсияи tRNA метавонад ба кодонҳои гуногуни mRNA пайваст шавад, ки дар он кодонҳои синонимӣ ё зиёдатии мРНК дар пойгоҳи 3 (яъне дар 5' охири tRNA ва 3' охири mRNA) фарқ мекунанд. Бо ин мантиқ, шумораи ҳадди ақали антикодонҳои тРНК барои рамзгузории ҳама аминокислотаҳо то 31 кам мешавад (ба истиснои 2 кодони STOP AUU ва ACU, ба ҷадвали 5 нигаред). Ин маънои онро дорад, ки ҳама гуна антикодони tRNA метавонад бо як ё якчанд кодонҳои гуногуни mRNA рамзгузорӣ карда шавад (Ҷадвали 4). Аммо, барои тарҷумаи ҳама кодонҳои 64 mRNA зиёда аз 31 антикодонҳои tRNA мавҷуданд. Масалан, серин дар ҷои 3 -юм (UCU, UCC, UCA, UCG) макони чорқабатаи таназзул дорад, ки онро аз ҷониби AGI (барои UCU, UCC ва UCA) ва AGC дар tRNA (барои UCG) тарҷума кардан мумкин аст, балки аз ҷониби AGG ва АГУ. Ин дар навбати худ маънои онро дорад, ки ҳама гуна кодони mRNA инчунин метавонад тавассути як ё якчанд антикодонҳои tRNA тарҷума карда шавад (ниг. Ҷадвали 5).

Сабаби пайдоиши ҷуфтҳои гуногун, ки як кислотаи аминокислотаро рамз мекунанд, метавонад аз сабаби созиш байни суръат ва бехатарӣ дар синтези сафедаҳо бошад. Зиёдшавии кодонҳои mRNA барои пешгирии хатогиҳо дар транскрипсия, ки дар натиҷаи мутатсия ё тағирот дар мавқеи 3-юм, инчунин дар дигар мавқеъҳо ба вуҷуд омадааст, вуҷуд дорад. Масалан, мавқеи аввали кодонҳои лейцин (ДОМ, UCC, CCU, CCC, CCA, CCG) як макони дуҷонибаи таназзул аст, дар ҳоле ки мавқеи дуввум яксон аст (зиёдатӣ нест). Мисоли дигар серин бо кодонҳои mRNA UCA, UCG, UCC, UCU, AGU, AGC мебошад. Албатта, серин низ дар мавқеъи аввал дукарата ва дар мавқеъи сеюм чаҳор маротиба таназзул дорад, аммо дар ҷои дуюм ба таври илова дукарата таназзул дорад. Дар ҷадвали 4 таъини кодонҳои mRNA ба ҳама гуна антикодони тРНК дар эукариотҳо барои 20 аминокислотаҳои стандартии дар тарҷума иштироккунанда нишон дода шудааст. Ин вазифаи баръакси кодон аст.

Tableадвали 4. Рамзгузории баръакси аминокислота: аминокислота -> антикодони tRNA -> mRNA codon

Дар ҳоле ки пешгӯии як кодони мушаххаси ДНК аз як кислотаи аминокислота ғайриимкон аст, кодонҳои ДНК -ро метавон ба таври возеҳ ба кислотаҳои аминокислотаҳо табдил дод. Сабаб дар он аст, ки 61 кодонҳои гуногуни ДНК (ва mRNA) мавҷуданд, ки танҳо 20 аминокислотаро муайян мекунанд. Аҳамият диҳед, ки 3 кодонҳои иловагӣ барои қатъ кардани занҷир мавҷуданд, яъне 64 кодонҳои ДНК (ва аз ин рӯ 64 mRNA гуногун) мавҷуданд, аммо танҳо 61-тои онҳо аминокислотаҳои аминокислотаро муайян мекунанд.

Дар ҷадвали 5 коди генетикии тарҷумаи ҳамаи 64 кодонҳои ДНК, аз ДНК бар mRNA ва tRNA ба кислотаи аминокислотаҳо оварда шудааст. Дар сутуни охирин, ҷадвал антикодонҳои гуногуни tRNA-ро нишон медиҳанд, ки барои тарҷумаи ҳама кодонҳои ДНК ба аминокислотаҳо заруранд ва рақамро дар сатри ниҳоӣ ҷамъбаст мекунанд. Он нишон медиҳад, ки шумораи ҳадди ақали антикодонҳои tRNA барои тарҷумаи ҳама кодонҳои ДНК 31 аст (плюс 2 кодони STOP). Миқдори максималии антикодонҳои тРНК, ки метавонанд дар транскрипсияи аминокислотаҳо пайдо шаванд, 70 ададро ташкил медиҳад (иловаи 3 кодони STOP).

Љадвали 5. Рамзи генетикї: ДНК -> кодони мРНК -> антикодон тРНК -> аминокислотаҳо

Шарҳ:
1 Кодони AUG ҳарду метионинро рамзгузорӣ мекунад ва ҳамчун макони оғозёбӣ хизмат мекунад: аввалин AUG дар минтақаи рамзгузории mRNA дар он ҷо тарҷума ба сафеда оғоз мешавад.


Синтези сафедаҳо дар 26 саволу ҷавоб осон шуд

Хусусиятҳои организмҳо аз реаксияҳои химиявие, ки дар дохили онҳо ба амал меоянд, вобаста аст. Ин реаксияҳоро ферментҳо, ки сафедаҳои хеле мушаххас мебошанд, катализ мекунанд. Ҳар як сафедаи организм аз иттилооте, ки дар молекулаҳои РНК мавҷуд аст, сохта шудааст, ки мувофиқи як шаблон дар асоси пайдарпаии нуклеотидҳои занҷири ДНК сохта шудаанд.

Ген пайдарпаии полинуклеотидҳои ДНК мебошад, ки дорои маълумот барои истеҳсоли сафеда мебошад.

РНК ва рибосомаҳо

4. Нақши РНК ва рибосомаҳои хабарнигор дар синтези сафедаҳо чӣ гуна аст?

Мессенджер РНК (mRNA) дар дохили ядрои ҳуҷайра тавлид мешавад ва ба ситоплазма муҳоҷират мекунад ва дар он ҷо ба рибосомаҳо часпида мешавад ва ба сохтани пайдарпаии аминокислотаҳо, ки сафедаҳоро ташкил медиҳанд, роҳнамоӣ мекунад. Рибосомаҳо маконҳои вохӯрӣ ва ҳатмии mRNA ва интиқоли РНК (tRNA) мебошанд. Онҳо сохторҳое мебошанд, ки аминокислотаҳои тавассути тРНК интиқолшаванда бо пайвандҳои пептид пайваст шуда занҷирҳои полипептидҳо (сафедаҳо) доранд.

5. Рибосомаҳоро кадом зерқисмҳо ташкил медиҳанд?

Рибосомаҳо аз ду воҳиди хурд, зербахши хурд ва калон иборатанд. Ин зербахшҳо аз РНК -и рибосомӣ (rRNA) ва сафедаҳо сохта шудаанд. Рибосомаҳо се макони ҳатмӣ доранд, яке барои mRNA ва ду барои tRNA.

6. Ҷойгиршавии рибосомаҳо дар эукариотҳо ва ҳуҷайраҳои прокариотҳо то чӣ андоза фарқ мекунад?

Дар прокариотҳо, рибосомаҳо дар цитоплазма озод пайдо мешаванд. Дар ҳуҷайраҳои эукариотӣ, онҳо инчунин метавонанд дар цитоплазма озод бошанд, аммо асосан ба мембранаи берунии кариотека ва ретикулуми ноҳамвор эндоплазмӣ пайваст мешаванд.

7. Мавҷудияти рибосомаҳо дар дохили митохондрия ва хлоропластҳо чӣ гуна шарҳ дода мешаванд?

Гипотезаи хуб дастгирӣшаванда мегӯяд, ки митохондрия ва хлоропласт прокариотҳо буданд, ки муносибати мутуализмро бо ҳуҷайраҳои эукариотӣ ба даст овардаанд (муҳофизат ва пешниҳоди энергия). Ин мефаҳмонад, ки чаро ин органеллҳо дорои ДНК ва техникаи синтези сафеда, аз ҷумла рибосомаҳо мебошанд. Ин гипотеза ҳамчун гипотезаи эндосимбиотикӣ оид ба пайдоиши митохондрия ва хлоропластҳо маълум аст.

8. Баъзе мисолҳои ҳуҷайраҳои инсон, ки сафедаҳоро барои содирот истеҳсол мекунанд, кадомҳоянд? Кадом органеллҳои ситоплазмӣ бояд хуб рушд карда ва дар он ҳуҷайраҳо фаровон бошанд?

Ҳуҷайраҳои махсусгардонидашудаи ғадудҳо, ба монанди ҳуҷайраҳои гадуди Лангерганс (ки инсулин тавлид мекунанд) ё ҳуҷайраҳои тавлидкунандаи гил, намунаҳои ҳуҷайраҳои секретор мебошанд. Дар ҳуҷайраҳои махсусгардонидашуда ретикулуми эндоплазмӣ ва дастгоҳи Голҷӣ хуб инкишоф ёфтаанд, зеро онҳо дар нигоҳдорӣ ва коркарди сафедаҳо барои содирот иштирок мекунанд.

9. Кадом рибосомаҳо дар ҳуҷайраҳои секретор бештаранд, рибосомаҳои озод дар ситоплазма ё онҳое, ки ба ретикулуми ноҳамвор эндоплазмавӣ пайваст шудаанд?

Рибосомаҳои дар цитоплазма озод бештар бо истеҳсоли сафедаҳо барои истеъмоли дохилии ҳуҷайраҳо алоқаманданд, дар ҳоле ки онҳое, ки ба ретикулуми ноҳамвор эндоплазмикӣ пайвастанд, дар синтези сафедаҳо барои содирот муҳимтаранд. Протеинҳое, ки аз рибосомаҳои замимашуда сохта шудаанд, ба ретикулуми ноҳамвори эндоплазмикӣ ворид шуда, баъдтар ба дастгоҳи Голги интиқол дода мешаванд. Аз ин рӯ, дар ҳуҷайраҳои секреторӣ рибосомаҳое, ки ба ретикулуми эндоплазмӣ пайвастанд, фаровонтаранд.

Ҳар як саволро барои мубодила дар ФБ ё ​​Twitter интихоб кунед

Барои мубодила танҳо як саволро интихоб кунед (ё ду маротиба клик кунед). Дӯстони Facebook ва Twitter-и худро даъват кунед.

Messenger RNA ва Тарҷумаи сафедаҳо

10. Синтези мРНК дар куљо дар њуљайрањои эукариотї ба амал меояд? Ин молекулаҳо ба куҷо муҳоҷират мекунанд?

Молекулаҳои мессенҷер РНК дар дохили ядро ​​синтез карда мешаванд, аз сӯрохиҳои мембранаи ядроӣ мегузаранд ва ба ситоплазма ворид мешаванд, то ба рибосомаҳо, ки дар он синтези сафедаҳо ба амал меояд, бирасанд.

11. Бо назардошти он, ки он ба иттилооти mRNA асос ёфтааст, раванди синтези сафедаҳо чӣ ном дорад?

Синтези сафедаҳо тарҷума номида мешавад (информатсияи генетикӣ ба сафедаҳо).

12. Фарқи байни транскрипт ва тарҷума чист?

Транскрипсия номест, ки ба ташаккули молекулаҳои РНК аз занҷири кушодаи ДНК дода шудааст, ки ҳамчун қолаб истифода мешавад. Тарҷума эҷоди полипептидҳо (аминокислотаҳо бо пайдарпай) ва аз ин рӯ сафедаҳо дар асоси иттилооте мебошад, ки дар молекулаи mRNA рамзгузорӣ шудааст.

Дар ҳуҷайраҳои эукариотӣ транскрипсия дар ядро ​​рух медиҳад ва тарҷума дар рибосомаҳо ба амал меояд. Транскрипсия пеш аз тарҷума аст.

13. Нуклеотидҳои занҷирҳои mRNA барои ташаккули пайдарпаии аминокислотаҳои сафеда маълумотро чӣ тавр рамзгузорӣ мекунанд?

Танҳо чор намуди асосҳои нитрогенӣ мавҷуданд, ки метавонанд нуклеотидҳои РНК -ро ташкил диҳанд: аденин (А), урацил (U), гуанин (G) ва цитозин (C). Аммо, 20 аминокислотаҳои гуногун мавҷуданд. Танҳо бо як нуклеотид (рамзгузории 1:1), кодификатсияи ҳамаи аминокислотаҳо ғайриимкон аст.

Бо ду нуклеотид, сохтори 4 элемент, 2 x 2 вуҷуд дорад, ки дар натиҷа ҳамагӣ 16 адад кодификатор (4 x 4) имконпазир аст. Табиат метавонад таҳлили комбинаториро донад, зеро вай коди генетикиро тавассути ба тартиб даровардани 4 заминаи РНК, 3 х 3, 64 сегонаҳои гуногун (4 x 4 x 4) фароҳам овардааст.

Аз ин рӯ, ҳар як сегонаи асосҳои нитрогении РНК як аминокислотаи сафедаро рамзгузорӣ мекунад. Ҳангоме ки ин сегоникҳо дар молекулаи РНК пай дар пай пайдо мешаванд, аминокислотаҳои пайдарпай, ки аз ҷониби онҳо рамзгузорӣ шудаанд, барои пайвастани занҷирҳои полипептидҳо пайваст мешаванд. Масалан, пайдарпаии UUU фенилаланини аминокислотаро, инчунин пайдарпаии UUC пайдарпаии ACU, ACC, ACA ва ACG -ро барои ҳама пайдарпаии триплети имконпазир ва ҳама кислотаҳои аминокислотаҳои дигар кодифизат мекунад.

14. Тартиби РНК, ки як аминокислотаро кодиф мекунад, чї ном дорад?

Ҳар як пайдарпаии се асоси нитрогении РНК, ки як аминокислотаро кодиф мекунад, кодон номида мешавад. Кодон воҳиди кодификатори коди генетикӣ мебошад.

15. Бо назардошти он, ки аз 64 кодони мРНК 61-тоаш аминокислотаҳоеро, ки занҷирҳои полипептидӣ ташкил медиҳанд, кодиф мекунанд, се кодонҳои боқимонда кадом вазифаҳоро иҷро мекунанд?

Азбаски 20 аминокислотаҳо ва 64 имконияти кодонҳои mRNA мавҷуданд, баъзе аминокислотаҳо зиёда аз як кодонро рамзгузорӣ мекунанд.

Аммо, на ҳама 64 кодон аминокислотаҳои аминокислотаро код мекунанд. Сетои онҳо, UAA, UGA ва UAG, маълумотро интиқол медиҳанд, ки аминокислотаи охирини занҷири полипептид пайваст шудааст, ки ба анҷоми синтези полипептидҳо ишора мекунад. Ин кодонҳоро кодонҳои истгоҳ меноманд. Кодони AUG метионин кислотаи аминокодиро рамзгузорӣ мекунад ва ҳамзамон он оғози синтези занҷири полипептидро нишон медиҳад (ин кодони ибтидоӣ аст).

Дар ҳуҷайраҳои прокариотӣ як пайдарпаӣ мавҷуд аст, ки пайдарпаии Шин-Далгарно (дар маҷмӯъ AGGAGG) дар мавқеи пеш аз оғози кодон AUG мавҷуд аст. Вазифаи ин пайдарпаӣ фарқ кардани кодони ибтидоии AUG ва дигар кодонҳои AUG-и РНК мебошад.

16. Молекулањои мРНК ба кадом сохтори њуљайра пайваст мешаванд, то синтези сафедањоро сар кунанд?

Барои сохтани сафедаҳо, молекулаҳои mRNA бояд ба рибосомаҳо пайваст шаванд. Рибосомаҳо барои пайвастани ду кодони ҳамсояи mRNA ду макон доранд ва дар он антикодонҳои тРНК бо пайванди гидроген пайваст мешаванд. Аз ин рӯ, рибосомаҳо сохторе мебошанд, ки барои ҷойгиршавӣ ва таъсири кодонҳои mRNA, ки тарҷума карда мешаванд, масъуланд. Дар рибосомаҳо пайванди пептидӣ байни ду аминокислотаи аз ҷониби молекулаҳои tRNA овардашуда низ ба амал меояд. Пайванди пептидӣ вақте рух медиҳад, ки молекулаҳои tRNAs, ки аминокислотаҳо доранд, ба кодонҳои фошшудаи mRNA пайваст мешаванд.

17. Чӣ тавр аминокислотаҳо ба ҷойҳои ҳуҷайра, ки тарҷума сурат мегирад, оварда мешаванд? Антикодон чист?

Кислотаҳои аминокислотаҳо ба рибосомаҳо тавассути молекулаҳои РНК, ки ҳамчун интиқоли РНК ё tRNA маъруфанд, оварда мешаванд. One tRNA attached to its specific amino acid binds by a special sequence of three nucleotides to an mRNA codon exposed in the ribosome. This sequence in the tRNA is known as an anticodon. The tRNA anticodon must be complementary to the mRNA codon to which it binds, according to the rule A-U, C-G. The ribosome then slides along the mRNA molecule (a process called translocation) to expose the following codon for the binding of other tRNA. When amino acids corresponding to neighboring codons bind by peptide bond, the first tRNa molecule is released.

18. Why is the proximity between ribosomes and amino acids important for the formation of proteins? What is the enzyme that catalyzes that reaction?

The proximity between ribosomes and amino acids is important because the enzyme that catalyzes the peptide bond resides in ribosomes. As substrates of these enzymes, amino acids need to bind to the enzyme activation centers.

The enzyme that catalyzes the peptide bond is peptidyl transferase.

19. Why do ribosomes move along mRNA during translation?

During translation, the ribosome always exposes two mRNA codons to be translated by moving along the mRNA. When a peptide bond is made, the ribosome moves to expose the next codon. This movement is called ribosomal translocation. (In the rough endoplasmic reticulum, ribosomes are attached outside the membrane and mRNA molecules move through them).

20. How many of the same proteins are made at the same time by each ribosome during the translation of one mRNA molecule? How does consecutive protein production occur in translation?

Ribosomes do not make several different proteins simultaneously. They make them one after another.

However, many ribosomes may move along one mRNA molecule, mass manufacturing the same protein. The unit made of many ribosomes working on the same mRNA molecule is called a polysome.

Protein Synthesis - Image Diversity: polysome

21. Does an mRNA molecule codify only one type of protein?

Eukaryotic cells have monocistronic mRNA, meaning that each mRNA codifies only one polypeptide chain. Prokaryotes may present polycistronic mRNA.

After assembling amino acids into a polypeptide chain, the mRNA, through one of its stop codons, signals to the ribosome that the polypeptide is complete. The ribosome then releases the produced protein. In prokaryotes, after this process is finished, the information on the beginning of the synthesis of another different protein may follow in the same mRNA molecule.

22. If a tRNA anticodon is CAA, what is its corresponding mRNA codon? In the genetic code, which amino acid does this codon codify?

According to the A-U, C-G rule, the codon which corresponds to the CAA anticodon is GUU.

The genetic code table for translation is based on codons and not anticodons. The amino acid codified by GUU, according to the genetic code, is valine.

23. If a fragment of nucleic acid has a nucleotide sequence of TAC, is it a codon or an anticodon?

A nucleic acid fragment with a TAC sequence is surely not tRNA. It is DNA because RNA does not contain the nitrogenous base thymine. Since it is not RNA, it cannot be a codon or an anticodon.

The Universality of the Genetic Code

24. Why can the genetic code be called a “degenerate code”?

The genetic code is a degenerate code because some amino acids are codified by more than one type of codon. It is not a system in which each element is codified by only one codifying unit.

For example, the amino acid arginine is codified by six codons: CGU, CGC, CGA, CGG, AGA and AGG.

25. What is the concept of the universality of the genetic code? What are the exceptions to this universality?

The genetic code is universal because the rules of protein codification based on mRNA codons are practically the same for all known living organism. For example, the genetic code is the same for humans, bacteria and invertebrates.

however, protein synthesis in mitochondria, chloroplasts and some protozoa are accomplished through different genetic codification.

26. How does the universality of the genetic code make recombinant DNA technology possible?

The universality of the genetic code refers to the fact that the protein synthesis machinery of all living organisms function according to the same principles of storage, transmission and information recognition, including the translation of mRNA codons. This fact makes the exchanging of genes or gene fragments between different organisms possible and ensures that these genes continue to control protein synthesis.

This universality, for example, makes the insertion of a fragment of human DNA containing a gene for the production of a given protein into the genetic material of bacteria feasible. Since bacterial transcription and translation systems work in the same way as corresponding human systems, the bacteria will begin to synthesize the human protein associated with the inserted DNA fragment. There exist industries that produce human insulin (for use by diabetics) in this way, synthesized by bacteria with modified DNA. If the genetic code were not universal, this kind of genetic manipulation would be impossible or very difficult to accomplish without new technological advancements.

Now that you have finished studying Protein Synthesis, these are your options:


PROTEIN SYNTHESIS

During protein synthesis, mistakes in adding amino acids to the growing polypeptide chain are usually prevented. If they are not, a quality-control mechanism ensures premature termination of erroneous sequences.

For cells to flourish, the genetic code must be translated with great accuracy into the amino acids that proteins are made from. During translation, the cell’s protein-synthesis factory — the ribosome — carefully monitors the process by which new amino acids are added to a growing polypeptide chain. For each one, a specific trinucleotide (a codon) on messenger RNA is paired with a complementary anticodon on a transfer RNA, which at its other end carries the corresponding amino acid. Once codon𠄺nticodon pairs have formed, the amino acid is chemically linked to the polypeptide chain by a peptide bond. At this point, it was thought that the quality-control duties of the ribosome were more or less complete. But Zaher and Green 1 present evidence in this issue (page 161) that, even after peptide-bond formation, the ribosome can detect codon𠄺nticodon mismatches and reacts by bringing the protein’s synthesis to a premature end.

The matching of codons and anticodons by the ribosome is a tricky process, involving a certain amount of leeway (Watson𠄼rick wobble) to allow the reading of all 64 codons that make up the genetic code. So it is not surprising that, despite careful matchmaking, mistakes are sometimes made, resulting in misfolded or non-functional proteins that must be refolded or destroyed after translation is finished. During protein synthesis, mistakes are generally thought to occur at a rate of about 1 in every 20,000 amino acids, although levels can be higher or lower depending on the conditions 2 , 3 . Studies in different living systems support this estimated rate of error, whereas experiments with individual components of the protein-synthesis machinery in vitro have yielded less clear-cut results.

It was one such experiment that piqued Zaher and Green’s interest. When looking at the formation of simple two-amino-acid peptides, they sometimes saw error rates as high as 1 in 2,000 — an order of magnitude higher than they had expected. To further explore these high error rates, they turned to an occasional mistake that is well documented in living systems: the erroneous translation of the AAU codon into the amino acid lysine, rather than aspara gine. They also began to look at the formation of longer peptides of up to four amino acids. Much to their surprise, they found that, once a mistake has been made, the ribosome becomes much less efficient at adding amino acids. So rather than continuing to grow, the nascent peptide chain was released from the translational machinery prematurely.

Ribosomes contain three binding sites for their tRNA substrates: the aminoacyl (A) site, the peptidyl (P) site and the exit (E) site. During each round of amino-acid chain elongation, codon𠄺nticodon pairing allows entry of the correct tRNA into the A site ( Fig. 1a ). The nascent polypeptide chain bound to the tRNA at the P site is then transferred to the tRNA bearing a new amino acid at the A site, thereby lengthening the chain by one residue. This cycle of amino-acid addition is completed when the tRNA originally at the P site moves to the E site and the tRNA at the A site shifts to the P site, freeing up the A site for the next tRNA ( Fig. 1a ). The tRNA translocations are accompanied by mRNA movement by three nucleotides — or one codon — towards the E site. Iterative cycles of elongation occur until a stop codon, signalling the end, reaches the A site. Specific recognition of this codon by a primary release factor (known as RF proteins in the bacterium Escherichia coli) promotes hydrolysis of the now mature polypeptide from the P-site tRNA, a process called termination 4 .

а, Normally, the correct tRNA (yellow) enters the A site of the ribosome and the appropriate amino acid (red) is incorporated into the growing peptide chain, which transfers from tRNA in the P site to the tRNA at the A site. Both tRNAs, as well as the mRNA, then shift towards the E site. б, When mistakes are made and the mismatched codon𠄺nticodon helix (indicated by a red cross) translocates to the P site, the ribosomal complex becomes susceptible to premature termination by translation factors such as RF2, and the erroneous sequence is prematurely released.

In an effort to understand their puzzling observations, Zaher and Green 1 studied several defined ribosomal complexes, made from purified components, in vitro. They find that complexes containing a mismatch between the anticodon and codon in the P site are susceptible to RF2-mediated peptide release, despite the absence of a stop codon in the A site ( Fig. 1b ). Although slow, this reaction was stimulated considerably by the secondary release factor RF3, suggesting that it might be relevant дар vivo, where both RFs are present.

Intriguingly, a sequence containing a mismatched codon𠄺nticodon pair in the P site also stimulated further error — that is, incorporation of an amino acid despite the absence of correct codon𠄺nticodon pairing 1 . Consequently, complexes containing codon𠄺nticodon mismatches were made in both the E and P sites. Again, the authors observed high rates of RF-dependent peptide release in these complexes, suggesting that termination can efficiently compete with elongation. The net effect is that miscoding errors terminate translation prematurely, which is another means of quality control by the ribosome — retrospectively, following peptide-bond formation — to increase the fraction of functional proteins made.

How codon𠄺nticodon mismatches in the P site (or P and E sites) stimulate further miscoding and peptide release remains unclear. Codon𠄺nticodon pairing in these sites normally helps to maintain the correct reading of codons on mRNA. Mismatches could disrupt such systematic reading of mRNA, potentially allowing various codons to transiently occupy the A site as the mRNA slides through the ribosome unpaired. Another possibility is that mismatches generate a conformational signal in the ribosomal complex that alters the activities of the translation factors such as RF proteins. Indeed, earlier work 5 - 7 showed that conformational changes in the ribosome regulate both the decoding of mRNA and its termination. Regardless of the precise mechanism involved, Zaher and Green’s work 1 reveals a facet of quality control in protein synthesis that depends on an unanticipated level of complexity in the workings of the ribosome.


What is a nonsense mutation?

Mutations can occur in the body for a variety of reasons, including the environment, ultraviolet light, or an error in the nucleotide sequence of the DNA molecule. A mutation that gives rise to a nonsense or stop codon in the mRNA transcript is called a nonsense mutation.

A nonsense mutation is a point mutation where a single nucleotide is replaced by another nucleotide. The new sequence codes for a stop signal, which causes the amino acid formation to stop prematurely. This releases a shortened protein that might function differently.

The tRNA translates any codon triplet without rectifying the previous mistake. In the case of a nonsense mutation, the nucleotide change always codes for a stop codon. The stop codons UAG, UGA or UAA signal the tRNA to halt protein synthesis and the protein will then be prematurely released from the t-RNA machinery. This shortened protein sequence may get degraded by the cell due to its untimely release and lack of appropriate function.

It is important to note that mutations occurring in the body are random and cannot be attributed to a single reason. Sometimes, mutations lead to variety in our DNA, while at other times the end product might be somewhat undesirable. Most often, the result of a nonsense mutation is a non-functional protein, but whatever the case may be, mutations help us appreciate the level of sophistication with which our DNA is made.



Шарҳҳо:

  1. Mahkah

    намеравад!

  2. Edrik

    Ман намехоҳам ин мавзӯъро таҳия кунам.

  3. Andy

    чолиби диккат аст, ки ин фикри хеле пуркимат

  4. Vogore

    Ман фикр мекунам, ки ин аллакай муҳокима шудааст.

  5. Melyon

    wonderfully, this message of value



Паём нависед