Маълумот

Тафтиши ДНК барои фарқ кардани намудҳои гуногун чӣ гуна истифода мешавад?


Чӣ тавр санҷиши ДНК барои муайян кардани он, ки намунаҳо ба намудҳои гуногун тааллуқ доранд, на ба зернамудиҳо ё аъзои як намуд? Одатан таърифи намудҳо дар бораи қобилияти тавлиди насли бордор дар шароити табиӣ аст. Чӣ гуна нишонаҳо интихоб карда мешаванд, ки нишон медиҳанд, ки фардҳо намудҳои гуногун мебошанд?

Ё ин раванд баръакс сурат мегирад? Оё намудҳо гуногунанд, пас ДНК барои муайян кардани кадом узвҳо истифода мешавад?


Омори тафовут

Шумо метавонед омори мухталифи ихтилофи гурӯҳҳоро ҳисоб кунед. Одатан шумо метавонед шумораи дугонаи фарқиятҳои байни ҳар як ҷуфти шахсони алоҳидаро баррасӣ кунед. Масалан, ду пайдарпаии зерин

ATATATCCTGTGTCAAAATATCTTGTGTCA

2 тафовут дорад.

Гурӯҳбандии ошкор ё норавшан

Аксар вақт, шахсон воқеан ба таври табиӣ гурӯҳбандӣ мекунанд (агар шумо таҳлили ҷузъии принсипиро анҷом диҳед, шумо гурӯҳҳои аниқ муайяншударо хоҳед дид), аммо баъзан гурӯҳҳо хеле норавшананд.

Таърифи намудҳо худсарона аст

Новобаста аз он ки гурӯҳбандӣ норавшан аст ё не, аксар вақт худсарона аст, ки чӣ қадар ду гурӯҳ бояд фарқ кунанд, то онҳоро дар популятсияҳо, зернамудҳои гуногун ё намудҳои гуногун, наслҳои гуногун ва ғайра тасниф кунанд…

Мушкилот дар ин ҷо бештар мушкилоти таъриф аст, на мушкилоти техникӣ. Барои фаҳмидани масъалаи таърифи намудҳо, шумо бояд ба ин паём назар кунед.


Кӯшиши ман дар шарҳи сатҳи мактаби миёна

Фаҳмонед, ки дарахти филогенетикӣ чист

Аввал дарахти филогенетикиро кашед. Фаҳмонед, ки онҳо чӣ маъно доранд:

  • Гиреҳ як аҷдоди умумист
  • Барг як намуди зинда аст (агар барг ба болои дарахт бирасад)
  • Ҳама намудҳо бо ҳам алоқаманданд, аммо баъзеҳо нисбат ба дигарон бештар робита доранд ...
  • Мафҳуми клауди хоҳарро муаррифӣ кунед
  • Фаҳмонед, ки ҳар як намуди хоҳар бо тамоми намудҳо дар синфи хоҳари дигар бо нишон додани аҷдоди умумии онҳо баробар алоқаманд аст.
  • Фаҳмонед, ки ягон намуди мавҷуда аҷдоди намуди дигар нест, зеро аҷдодон гиреҳ мебошанд.

Шумо метавонед дар бораи дарахтони филогенетикӣ дар ин ҷо дар Biology.SE ё дар ин ҷо дар бораи фаҳмидани эволютсия кӯтоҳ маълумот гиред.

Усулҳои барқарорсозии дарахти филогенетикӣ

Бигзор онҳо ҳайрон шаванд, ки чӣ тавр мо метавонем донем, ки дарахти ҳақиқии филогенетикӣ чист.

Пешниҳод кунед, ки маълумотҳои фенотипиро истифода баред ва онҳоро дарк кунед ва агар шумо ҳамаи гулҳои зардро якҷоя кунед, ё организмҳои парвозкунанда (ҳашарот, паррандагон, куршапаракҳо, сутунҳо) он қадар хуб кор намекунад. Ҳамин тариқ, маълумоти фенотипӣ баъзан метавонанд иштибоҳ кунанд. Пас фаҳмонед, ки мо метавонем маълумоти генетикиро тавассути ҳисоб кардани шумораи фарқиятҳои ҷуфт истифода барем. Биёед се пайдарпаии гуногунро баррасӣ кунем

намуди А:ATCTCTGнамуди B:ATCTCTTнамуди C:АГГКАТТ

Чунин ба назар мерасад, ки ду пайдарпаии аввал нисбат ба яке аз онҳо бо пайдарпаии сеюм зичтар алоқаманданд. Шумо метавонед дарахтро барои ин се намуд кашед.

Соати молекулавӣ (ихтиёрӣ)

Донистани суръати пайдоиши мутация, метавон аз он замон метавон муайян кард, ки ду насл дар асоси маълумоти генетикӣ аз ҳам ҷудо шудаанд. Ба шумо лозим меояд, ки дар бораи соати молекулавӣ барои худ каме бештар омӯзед. Шумо метавонед дар мақолаи дигар шарҳи мактаби миёнаро пурсед.

Дар доираи гуногунии аҳолӣ (ихтиёрӣ)

Эътироф кардани мавҷудияти гуногунии генетикӣ дар дохили популятсия калиди тамоми равандҳои эволютсионист, аз ин рӯ хуб аст, ки ба онҳо имкон диҳед, ки мавҷудияти чунин гуногуниро барвақт дарк кунанд.

Албатта, дар дохили як намуд гуногунии генетикӣ мавҷуд аст, ки ҳама чизро каме мураккабтар мекунад. Масалан, баъзеи шумо чашмони кабуд доред ва дигарон чашмони қаҳваранг (бо назардошти фарқияти ранги чашм дар байни донишҷӯёни шумо), ин ба он вобаста аст, ки пайдарпаии ДНК дар ҳар яки шумо каме фарқ мекунад. На он қадар фарқ мекунад, ки байни одамон ва шимпанзе аст, аммо каме фарқ мекунад.

Маълумоти генетикӣ барои гурӯҳбандии популятсияҳо ба намудҳо

Пас, шумо метавонед бигӯед, ки маълумоти генетикӣ ба мо имкон медиҳад, ки гурӯҳҳоро аз ҳам ҷудо кунем. Шумо метавонед як намуди қитъаи PCA -ро нишон диҳед (бе он ки воқеан PCA чист) бо рангҳо. Ҳар як ранг ба популятсия мувофиқат мекунад (дар бораи аҳолии мӯҳлатӣ, на намудҳо). Чизе монанди

ва он гоҳ ба таври ғайрирасмӣ баҳс кунед, ки популятсияҳои зард-сабз, сабз ва сурх эҳтимолан намудҳои гуногунанд, дар ҳоле ки ҳамаи популятсияҳои дигар ба як намуд мансубанд.

Мушкилот бо таърифи намуд

Агар шумо дар ҳақиқат мехоҳед саволеро дар бораи чӣ гуна истифода бурдани маълумоти генетикӣ барои ҷудо кардани намудҳо пешкаш кунед, пас шумо аввал бояд мафҳуми намудҳои онҳоро нест кунед! Барои ин, шумо бояд аввал ин мақоларо бубинед. Ба шумо лозим меояд

  • Мафҳуми биологии намудҳоро ҷорӣ кунед
  • Фаҳмонед, ки чаро ин консепсия барои намудҳои асексуалӣ кор намекунад (умедворем, ки онҳо медонанд, ки бисёр намудҳо асексуалӣ мебошанд).
  • Мисоли як масъалаи дигарро ба монанди намунаи классикии (вале кам мушоҳидашавандаи) намудҳои ҳалқаҳо диҳед (нигаред ба ин ҷо дар бораи Biology.SE ё дар ин ҷо дар Википедия)

Пас, ба PCA баргардед ва бипурсед, ки ду популятсия чӣ гуна бояд гуногун бошанд, то онҳоро намудҳои гуногун номиданд? Ва онҳоро водор созед, ки ин худсарона аст. Мо метавонем бигӯем, ки онҳо наслҳои гуногунанд, аммо ба ҳама вобаста аст, ки мо чӣ гуна навъ номиданӣ ҳастем. Бо вуҷуди ин, аксар вақт эҳсоси норавшан дар бораи он ки чӣ гуна навъ бояд гуногун бошад, кофӣ аст.


Тафовут дар байни RAPD ва RFLP

Маркерҳои генетикӣ дар биологияи молекулавӣ барои муайян кардани фарқиятҳои генетикӣ байни шахсон ва намудҳо истифода мешаванд. ДНК-и тасодуфии пурқувватшудаи полиморфӣ (RAPD) ва Полиморфизми дарозии қисмҳои маҳдуд (RFLP) ду нишондиҳандаи муҳими молекулавӣ мебошанд, ки мунтазам дар лабораторияҳо истифода мешаванд. RAPD бо праймерҳои кӯтоҳ ва ихтиёрии олигонуклеотидҳо иҷро карда мешавад ва он ба амплификацияи тасодуфии ҷойҳои сершумор дар тамоми ДНК-и қолаби организм асос ёфтааст. RFLP бо эндонуклеазаи маҳдудкунанда иҷро карда мешавад ва он ба полиморфизми порчаҳои маҳдудкунии натиҷавӣ ва гибридизатсия асос ёфтааст. Фарқи калидии RAPL ва RFLP дар он аст RAPD як намуди техникаи ПТР аст, ки бидуни огоҳии пайдарпайии пешакӣ иҷро карда мешавад дар ҳоле ки RFLP дар PCR иштирок намекунад ва барои иҷрои техника дониши пешакии пайдарпайро талаб мекунад.


Ду тадбири монандӣ

Организмҳое, ки хусусиятҳои шабеҳи физикӣ доранд ва пайдарпаии генетикӣ одатан нисбат ба онҳое, ки надоранд, зичтар алоқаманданд. Хусусиятҳое, ки ҳам аз ҷиҳати морфологӣ ва ҳам аз ҷиҳати генетикӣ ба ҳам мувофиқанд, сохторҳои гомологӣ номида мешаванд, ки шабоҳатҳо аз роҳҳои умумии эволютсионалӣ бармеоянд. Масалан, чи тавре ки дар расми 12.2.1 нишон дода шудааст, устухонхои болхои куршамбанда ва паррандагон, дастони одамон ва пои пеши асп сохторхои гомологи мебошанд. Аҳамият диҳед, ки сохтор на танҳо як устухон аст, балки як гурӯҳи чанд устухонест, ки дар ҳар як организм ба ҳамин тарз ҷойгир шудаанд, гарчанде ки унсурҳои сохтор шояд шакл ва андозаашонро тағйир дода бошанд.

Расми 12.2.1: Болҳои куршашпарак ва паррандаҳо, пои пеши асп, панҷаи наҳанг ва бозуи одам сохторҳои гомологӣ мебошанд, ки нишон медиҳанд, ки куршапаракҳо, паррандагон, аспҳо, наҳангҳо ва одамон гузаштаи эволютсионии муштарак доранд. (қарзи акс: тағир додани кори Стив Ҳилабранд, қарзи USFWS b акс: тағирёбии кор аз ҷониби кредити ИМА BLM в акс: тағир додани кор аз ҷониби Вирендра Канкария кредит д акс: тағир додани кори Ҳукумати Русия./Викимедиа Commons)

Намуди зоҳирии гумроҳкунанда

Баъзе организмҳо метавонанд бо ҳам зич алоқаманд бошанд, гарчанде ки тағироти ночизи генетикӣ боиси фарқияти калони морфологӣ гашт, то онҳоро ба куллӣ фарқ кунанд. Масалан, шимпанзе ва одамон, ки косахонаи сари онҳо дар расми 12.2.2 нишон дода шудааст, аз ҷиҳати генетикӣ хеле шабеҳанд ва 99 фоизи 1 генҳои худро тақсим мекунанд. Бо вуҷуди ин, шимпанзеҳо ва одамон фарқиятҳои назарраси анатомӣ доранд, аз ҷумла дараҷаи баромадани ҷоғ дар калонсолон ва дарозии нисбии дасту пойҳои мо.

Расми 12.2.2: (а) Ҷоғи шимпанзе нисбат ба (б) даҳони инсон ба дараҷаи хеле зиёдтар мебарояд. (қарзӣ: тағир додани кор аз ҷониби & quotPastorius & quot/Wikimedia Commons)

Бо вуҷуди ин, организмҳои ба ҳам алоқаманд метавонанд аз ҳам дур бошанд, аммо хеле ба ҳам монанданд, одатан аз он сабаб, ки мутобиқшавии умумӣ ба шароити шабеҳи муҳити зист дар ҳарду ба вуҷуд омадааст. Мисол шаклҳои танзими бадан, шакли қанотҳо ва замимаҳо ва шакли думҳо дар моҳӣ ва китҳо, ки ширхӯрон мебошанд. Ин сохторҳо шабоҳати рӯякӣ доранд, зеро онҳо мутобиқшавӣ ба ҳаракат ва манёвр дар як муҳит ва mdashwater мебошанд. Вақте ки хусусияти шабеҳ ба воситаи конвергенсияи мутобиқшавӣ (эволютсияи конвергентӣ) ба вуҷуд меояд, на аз сабаби робитаи наздики эволютсионӣ, онро сохтори шабеҳ меноманд. Дар мисоли дигар, ҳашарот болҳоро истифода мебаранд, то мисли кӯршапаракҳо ва паррандаҳо парвоз кунанд. Мо онҳоро ҳарду бол меномем, зеро онҳо як вазифаро иҷро мекунанд ва шакли зоҳирӣ доранд, аммо пайдоиши ҷанинии ду бол тамоман дигаранд. Тафовут дар рушд ё эмбриогенези болҳо дар ҳар як ҳолат сигналест, ки ҳашарот ва кӯршапаракҳо ё паррандагон як аҷдоди муштараке надоранд, ки бол дошта бошанд. Сохторҳои болҳо, ки дар расми 12.2.3 нишон дода шудаанд, дар ду насл мустақилона инкишоф ёфтаанд.

Хусусиятҳои шабеҳ метавонанд ҳам гомологӣ ва ҳам шабеҳ бошанд. Хусусиятҳои гомологӣ як роҳи эволютсиониро тақсим мекунанд, ки ба рушди ин хислат оварда расонд ва хислатҳои шабеҳ ин тавр нестанд. Олимон бояд муайян кунанд, ки кадом хусусияти монандӣ барои фаҳмидани филогенияи организмҳои омӯхташуда нишон медиҳад.

Расми 12.2.3: Боли занбӯри асал аз ҷиҳати шакл ба боли парранда ва боли куршашпарак монанд буда, як вазифаро (парвоз) иҷро мекунад. Паррандаҳо ва болҳои гурба сохторҳои гомологӣ мебошанд. Аммо, боли занбӯри асал сохтори дигар дорад (он аз экзоскелети хитинӣ сохта шудааст, на эндоскелети устухон) ва пайдоиши ҷанин. Навъҳои болҳои занбӯри асал ва парранда ё мушҳо шабеҳ ва сохтори шабеҳро нишон медиҳанд, ки таърихи эволютсионӣ надоранд. (Аксро қарз диҳед: тағир додани кор аз ҷониби кредити BLM ИМА б: тағир додани кор аз ҷониби Стив Хиллебранд, кредити USFWS в: тағир додани кор аз ҷониби Ҷон Салливан)

Ин вебсайт якчанд мисол дорад, то нишон диҳад, ки намуди зоҳирӣ дар фаҳмидани муносибатҳои филогенетикии организмҳо гумроҳкунанда аст.

Бо пешрафти технологияи ДНК, соҳаи систематикаи молекулавӣ, ки истифодаи маълумотро дар бораи сатҳи молекулавӣ, аз ҷумла пайдарпаии ДНК тавсиф мекунад, гул кард. Таҳлили нави аломатҳои молекулавӣ на танҳо бисёр таснифоти қаблиро тасдиқ мекунад, балки хатогиҳои қаблан содиршударо низ ошкор мекунад. Аломатҳои молекулавӣ метавонанд фарқиятро дар пайдарпаии аминокислотаҳои сафеда, фарқият дар пайдарпаии инфиродии нуклеотидҳои ген ё фарқияти сохтори генҳоро дар бар гиранд. Филогенияҳо дар асоси аломатҳои молекулавӣ тахмин мекунанд, ки ҳар қадар пайдарпаӣ дар ду организм монанд бошад, ҳамон қадар онҳо ба ҳам наздиктаранд. Генҳои гуногун бо суръати гуногун дар таҳаввулот тағир меёбанд ва ин ба дараҷае таъсир мерасонад, ки онҳо дар муайян кардани муносибатҳо муфиданд. Пайдарпайии босуръат инкишофёбанда барои муайян кардани муносибатҳои байни намудҳои ба ҳам наздик муфид мебошанд. Пайдарпайии сусттар инкишофёбанда барои муайян кардани муносибатҳои байни намудҳои дурдаст муфид аст. Барои муайян кардани муносибатҳои байни намудҳои хеле гуногун, аз қабили Эукария ва Археа, генҳои истифодашуда бояд генҳои хеле қадимӣ ва оҳиста таҳаввулшаванда бошанд, ки дар ҳарду гурӯҳ мавҷуданд, ба монанди генҳои РНК рибосомӣ. Муқоиса кардани дарахтони филогенетикӣ бо истифода аз пайдарпаии гуногун ва дарёфти шабеҳи онҳо барои мустаҳкам кардани эътимод ба муносибатҳои тахминшуда кумак мекунад.

Баъзан ду сегменти ДНК дар организмҳои дурдаст ба таври тасодуфӣ фоизи баланди асосҳоро дар як макон тақсим мекунанд, ки ин организмҳо ҳангоми набудани онҳо бо ҳам зич алоқаманданд. Масалан, пашшаи мевагӣ 60 дарсади ДНК-и худро бо одамон тақсим мекунад. Дар ин ҳолат, алгоритмҳои омории компютерӣ барои муайян кардани муносибатҳои воқеӣ таҳия карда шуданд ва дар ниҳоят, истифодаи ҳамгирои ҳам иттилооти морфологӣ ва ҳам молекулавӣ дар муайян кардани филогения муассиртар аст.

ЭВОЛЮЦИЯ ДАР АМАЛ: Чаро Филогения муҳим аст?

Илова ба баланд бардоштани фаҳмиши мо дар бораи таърихи эволютсионии намудҳо, аз ҷумла таҳлили филогенетикӣ, барномаҳои сершумори амалӣ дорад. Ду аз ин барномаҳо фаҳмидани эволютсия ва интиқоли бемориҳо ва қабули қарорҳо дар бораи кӯшишҳои ҳифзи табиатро дар бар мегиранд. Таҳқиқоти 3-и MRSA (тобовар ба метициллин) дар соли 2010 Staphylococcus aureus), бактерияи патогении ба антибиотик тобовар, пайдоиш ва паҳншавии штаммро дар тӯли 40 соли охир пайгирӣ кардааст. Тадқиқот вақт ва шаклҳоеро ошкор кард, ки дар он штамми тобовар аз нуқтаи пайдоиши худ дар Аврупо ба марказҳои сироят ва эволютсия дар Амрикои Ҷанубӣ, Осиё, Амрикои Шимолӣ ва Австралия кӯчид. Таҳқиқот нишон дод, ки муаррифии бактерияҳо ба популятсияҳои нав хеле кам, шояд танҳо як маротиба рух дода, сипас аз он шумораи маҳдуди афрод паҳн шудааст. Ин дар муқоиса бо эҳтимолияти он аст, ки бисёр одамон бактерияҳоро аз як ҷо ба ҷои дигар интиқол додаанд. Ин натиҷа аз он шаҳодат медиҳад, ки кормандони соҳаи тандурустӣ бояд диққати худро ба зуд муайян кардани тамосҳои афроди мубталои як навъи нави бактерияҳо равона кунанд, то паҳншавии онро назорат кунанд.

Як соҳаи дуввуми муфид барои таҳлили филогенетикӣ дар ҳифз аст. Биологҳо баҳс карданд, ки на танҳо аз як шохаи дарахт муҳофизат кардани намудҳо дар тамоми дарахти филогенетикӣ муҳим аст. Иҷрои ин варианти бештареро, ки эволютсия тавлид кардааст, нигоҳ медорад. Масалан, кӯшишҳои ҳифз бояд ба як намуди бе намудҳои хоҳар нигаронида шаванд, на ба як намуди дигаре, ки кластери намудҳои хоҳари наздики ба наздикӣ падидомада. Агар як намуди ягонаи эволютсионӣ аз байн биравад, миқдори номутаносиби дарахт дар муқоиса бо як намуд дар кластери намудҳои ба ҳам наздик алоқаманд нест мешавад. Тадқиқоте, ки соли 2007 нашр шуд 4 тавсияҳо оид ба ҳифзи намудҳои ширхӯронро дар саросари ҷаҳон вобаста ба он ки чӣ гуна аз ҷиҳати эволютсионӣ фарқ мекунанд ва дар зери хатари нестшавӣ қарор доранд, пешниҳод кард. Таҳқиқот нишон дод, ки тавсияҳои онҳо аз афзалиятҳо вобаста ба сатҳи хатари нобудшавӣ ба намудҳо фарқ мекунанд. Таҳқиқот муҳофизат кардани баъзе ширхӯронҳои калони таҳдидшаванда ва арзишманд ба монанди орангутанҳо, пандаҳои азим ва хурдтар ва филҳои Африқо ва Осиёро тавсия додааст. Аммо онҳо инчунин дарёфтанд, ки баъзе намудҳои нисбатан кам маълум бояд вобаста ба фарқияти эволютсионии онҳо ҳифз карда шаванд. Ба инҳо як қатор ҳояндаҳо, куршашпаракҳо, хорпуштҳо ва хорпуштҳо дохил мешаванд. Илова бар ин, баъзе намудҳои аз ҷиҳати ҷиддӣ зери хатар қарордошта мавҷуданд, ки дар фарқияти эволютсионӣ он қадар муҳим арзёбӣ нашудаанд, аз ҷумла намудҳои мушҳои буғӣ ва гербилҳо. Гарчанде ки бисёр меъёрҳо ба қарорҳои ҳифзи табиат таъсир мерасонанд, нигоҳ доштани гуногунии филогенетикӣ роҳи объективии ҳифзи доираи пурраи гуногунии эволютсияро таъмин мекунад.

Олимон дарахтони филогенетикиро чӣ гуна месозанд? Дар айни замон, усули маъмултарин барои сохтани дарахтони филогенетикӣ усули кладистикӣ номида мешавад. Ин усул организмҳоро ба кладҳо, гурӯҳҳои организмҳое ҷудо мекунад, ки бо ҳам зичтар алоқаманданд ва аҷдоди онҳо, ки аз онҳо ба вуҷуд омадаанд. Масалан, дар расми 12.2.4, тамоми организмҳои минтақаи сояафкан аз як аҷдоди ягона, ки тухмҳои амниотикӣ доштанд, пайдо шудаанд. Аз ин рӯ, ҳамаи ин организмҳо инчунин тухмҳои амниотикӣ доранд ва як қабати ягона доранд, ки онро гурӯҳи монофилӣ низ меноманд. Кладҳо бояд намудҳои аҷдодӣ ва ҳамаи наслҳоро аз нуқтаи шоха дар бар гиранд.

Калтакалакҳо, харгӯшҳо ва одамон ҳама аз як аҷдоди умумӣ, ки дар он тухми амниотикӣ ба вуҷуд омадааст, мераванд. Ҳамин тариқ, калтакалосҳо, харгӯшҳо ва одамон ҳама ба гурӯҳи Амниота тааллуқ доранд. Vertebrata як клади калонтарест, ки он инчунин моҳӣ ва лампрейро дар бар мегирад.

Кадом ҳайвонҳои ин расм ба кладе тааллуқ доранд, ки ҳайвонҳои мӯйдорро дар бар мегирад? Кадом аввалин эволютсия кард: мӯй ё тухми амниотикӣ?

Сарпӯшҳо метавонанд вобаста ба кадом нуқтаи филиал истинод карда шаванд, аз рӯи андоза фарқ кунанд. Омили муҳим он аст, ки ҳама организмҳои гурӯҳи клад ё монофилӣ аз як нуқтаи дарахт сарчашма мегиранд. Инро дар хотир доштан мумкин аст, зеро монофилетика ба & ldquomono, & rdquo ба маънои як ва & ldquophyletic, & rdquo ба маънои муносибати эволютсионӣ тақсим мешавад.

Хусусиятҳои муштарак

Кладистика ба се фарзия такя мекунад. Якум ин аст, ки мавҷудоти зинда аз рӯи насл аз аҷдоди умумӣ алоқаманданд, ки фарзияи умумии эволютсия аст. Дуюм, он аст, ки навъсозӣ бо ду тақсим шудани як намуд ба амал меояд, ҳеҷ гоҳ дар як вақт на бештар аз ду ва аслан дар як вақт. Ин то андозае баҳснок аст, аммо барои аксари биологҳо ҳамчун соддакунӣ қобили қабул аст. Фарзияи сеюм ин аст, ки хусусиятҳо бо мурури замон ба қадри кофӣ тағир меёбанд, то дар ҳолати дигар ҳисоб карда шаванд .Инчунин тахмин карда мешавад, ки метавон самти воқеии тағиротро дар як давлат муайян кард. Ба ибораи дигар, мо тахмин мезанем, ки тухми амниотикӣ нисбат ба тухмҳои амниотикӣ як ҳолати дертар аст. Инро полярии тағирёбии характер меноманд. Мо инро бо истинод ба гурӯҳи берун аз синф медонем: масалан, ҳашарот тухмҳои амниотикӣ надоранд, бинобар ин, ин ҳолати кӯҳна ё аҷдодӣ мебошад. Кладистика гурӯҳҳо ва гурӯҳҳоро муқоиса мекунад. Як гурӯҳ (калтакалос, харгӯш ва инсон дар мисоли мо) гурӯҳи таксонҳоест, ки таҳлил карда мешаванд. Гурӯҳи гурӯҳӣ (ланцелет, ламплей ва моҳӣ дар мисоли мо) як намуд ё гурӯҳи намудҳоест, ки пеш аз насли дорои гурӯҳ (ҳо) -и манфиатдор фарқ мекарданд. Бо мукоисаи аъзоёни гурух бо хамдигар ва аъзоёни берун аз гурух, мо метавонем муайян кунем, ки кадом хусусиятхо дигаргунихои эволютсиони мебошанд, ки нуктахои шохаи филогенияи гурухро муайян мекунанд.

Агар хусусият дар ҳамаи аъзоёни гурӯҳ пайдо шавад, ин як хислати муштараки аҷдодон аст, зеро ҳангоми фуруд омадани ҳар як аъзои клад дар хислат тағирот ба амал наомадааст. Гарчанде ки ин хислатҳо ҷолиб ба назар мерасанд, зеро онҳо кладро муттаҳид мекунанд, аммо дар кладистика онҳо ҳангоми кӯшиши муайян кардани муносибатҳои аъзои клад муфид ҳисобида намешаванд, зеро ҳар як узв якхела аст. Баръакс, хусусияти тухми амниотикии расми 12.2.4 -ро баррасӣ кунед. Танҳо баъзе аз организмҳо ин хислатро доранд ва ба онҳое, ки чунин хусусият доранд, онро аломати муштарак меноманд, зеро ин хислат дар лаҳзаи насл тағир ёфтааст. Ин хислат ба мо дар бораи муносибатҳои байни аъзои клад нақл мекунад, ки ба мо мегӯяд, ки калтакалосҳо, харгӯшҳо ва одамон нисбат ба ҳама гуна ин организмҳо бо моҳӣ, чароғҳо ва лансетҳо зичтар муттаҳид мешаванд.

Як ҷанбаи баъзан печидаи аломатҳои &ldquoancestral&rdquo ва &ldquoderived&rdquo он аст, ки ин истилоҳҳо нисбӣ мебошанд. Вобаста аз диаграммаи истифодашаванда ва организмҳои муқоисашаванда, ҳамон як хислат метавонад ё аҷдодӣ бошад ё гирифта шавад. Олимон ин истилоҳотро ҳангоми фарқ кардани кладҳо ҳангоми сохтани дарахтони филогенетикӣ муфид меҳисобанд, аммо дар хотир доштан муҳим аст, ки маънои онҳо аз контекст вобаста аст.

Интихоби муносибатҳои дуруст

Сохтани дарахти филогенетикӣ ё кладограмма аз маълумоти аломатҳо як вазифаи бузургест, ки одатан ба компютер гузошта мешавад. Компютер дарахтеро тавре мекашад, ки ҳамаи кладҳо як рӯйхати аломатҳои ҳосилшударо дошта бошанд. Аммо қарорҳои дигар бояд қабул карда шаванд, масалан, агар ҳузури намудҳо дар як клад аз ҷониби ҳама аломатҳои муштараки ҳосилшудаи ин клад дастгирӣ карда шавад, ба истиснои як? Як хулоса ин аст, ки хислат дар аҷдод инкишоф ёфтааст, аммо баъдан дар ҳамон як намуд дигар шудааст. Инчунин ҳолати аломатҳое, ки дар ду клад пайдо мешаванд, бояд тахмин карда шавад, ки дар ин кладҳо мустақилона инкишоф ёфтаанд. Ин номувофиқӣ дар дарахтоне, ки аз маълумоти аломатҳо гирифта шудаанд, маъмул аст ва раванди қабули қарорро душвор мегардонад, ки кадом дарахт муносибатҳои воқеии байни таксонҳоро аз ҳама зичтар ифода мекунад.

Барои кӯмак расонидан ба вазифаи азими интихоби дарахти беҳтарин, олимон аксар вақт мафҳумеро истифода мебаранд, ки парсимонияи ҳадди аксар ном дорад, ки маънои онро дорад, ки рӯйдодҳо ба таври соддатарин ва возеҳтарин ба амал омадаанд. Ин маънои онро дорад, ки дарахти & ldquobest & rdquo онест, ки шумораи ками тағир додани аломатҳо, шумораи ками тағироти аломатҳои мустақил ва камтарин шумораи тағирот дар тамоми дарахт аст. Барномаҳои компютерӣ аз тамоми дарахтони имконпазир ҷустуҷӯ мекунанд, то шумораи ками дарахтонро бо соддатарин роҳҳои эволютсионӣ пайдо кунанд. Олимон аз ҳамаи аломатҳои гомологии як гурӯҳи организмҳо сар карда, метавонанд тартиби рӯйдодҳои эволютсиониро муайян кунанд, ки ин хислатҳо аз ҳама равшан ва соддатаринанд.

Парсимонияро машқ кунед: Ба ин вебсайт равед, то бифаҳмед, ки чӣ гуна ҳадди аксар парсимония барои сохтани дарахтони филогенетикӣ истифода мешавад (боварӣ ҳосил кунед, ки ба саҳифаи дуюм идома диҳед).


Таҳлили молекулавии сафедаҳо

Дар бисёр ҳолатҳо омӯзиши ДНК ё РНК мустақиман матлуб ё имконнопазир аст. Протеинҳо метавонанд иттилооти мушаххаси намудҳоро барои муайянсозӣ ва инчунин маълумоти муҳимро дар бораи чӣ гуна ва оё ҳуҷайра ё бофта ба мавҷудияти микроорганизми патогенӣ ҷавоб медиҳанд. Протеинҳои гуногун барои ҷудокунӣ ва тавсиф усулҳои гуногунро талаб мекунанд.

Полиакриламид гели электрофорез

Як варианти электрофорези gel, ном дорад электрофорези гели полиакриламидӣ (PAGE), одатан барои ҷудо кардани сафедаҳо истифода мешавад. Дар САҲИФА, матритсаи gel лоғартар аст ва ба ҷои агароза аз полиакриламид иборат аст. Илова бар ин, PAGE одатан бо истифода аз дастгоҳи амудии гел иҷро карда мешавад (Расми 6). Аз сабаби зарядҳои гуногуне, ки бо занҷирҳои паҳлӯии аминокислотаҳо алоқаманданд, PAGE метавонад барои ҷудо кардани сафедаҳои солим дар асоси зарядҳои холиси онҳо истифода шавад. Интихобан, сафедаҳо метавонанд денатурат карда шаванд ва бо як шустушӯй заряди манфии номида пӯшонида шаванд сульфати натрий (SDS), ниқоб кардани зарядҳои ватанӣ ва иҷозат додани ҷудошавӣ танҳо аз рӯи андоза. PAGE метавонад минбаъд барои ҷудо кардани сафедаҳо дар асоси ду хусусият, ба монанди зарядҳои онҳо дар рНҳои гуногун ва инчунин андозаи онҳо тавассути истифодаи Саҳифаи дуҷониба. Дар ҳар яке аз ин ҳолатҳо, пас аз электрофорез, сафедаҳо тавассути рангкунӣ визуалӣ карда мешаванд, одатан бо доғи Coomassie ё доғи нуқра.

Тасвири 6. Барои тасвири калонтар клик кунед. (a) SDS як маводи шустушӯйест, ки сафедаҳоро денатурат мекунад ва зарядҳои аслии онҳоро ниқоб мекунад ва онҳоро яксон заряди манфӣ мекунад. (б) Раванди SDS-PAGE дар ин қадамҳо тасвир шудааст. (в) Акси гели SDS-PAGE тасмаҳои рангашудаи Coomassie-ро нишон медиҳад, ки сафедаҳои андозаашон гуногун дар баробари гел дар посух ба шиддати додашуда муҳоҷират кардаанд. Дар тарафи рости гел хати стандартии андоза намоён аст. (кредити б: тағир додани кор аз ҷониби “GeneEd ”/YouTube)

Дар бораи он фикр кунед

Фокуси клиникӣ: Карни, Қисми 3

Ин мисол ҳикояи Карниро, ки дар Микробҳо ва Асбобҳои муҳандисии генетикӣ ва болотар оғоз шудааст, идома медиҳад.

Расми 7. Доғи чашм яке аз нишонаҳои маъмулии бемориҳои Лайма аст, аммо то 30% шахсони сироятшуда ҳеҷ гоҳ доғе ба вуҷуд намеоранд. (қарз: Марказҳои назорат ва пешгирии бемориҳо)

Вақте ки Карни нишонаҳои худро тавсиф кард, табиби ӯ дар аввал гумонбар шуд, ки бактерия дорад менингит, ки бо дарди сар ва гардани сарди ӯ мувофиқ аст. Аммо, вай дере нагузашта ин имконро истисно кард, зеро менингит одатан назар ба он чизе ки Карни аз сар мегузаронд, зудтар пеш меравад. Бисёре аз нишонаҳои вай то ҳол ба нишонаҳои он монанданд склерози паҳлӯии амиотрофӣ (ALS) ва эритематозаи системавии лупус (SLE), ва табиб низ ба назар гирифтааст Бемории Лайма имкониятест, ки Карни дар ҷангал чӣ қадар вақт сарф мекунад. Карни ягон нешзании кандаҳоро ба ёд наовард (воситаи маъмулии интиқоли бемории Лайме) ва вай доғи маъмулии чашми барзаговро, ки бо бемории Лайма алоқаманд буд, надошт (Расми 7). Бо вуҷуди ин, 20-30% беморони гирифтори бемории Лайма ҳеҷ гоҳ ин доғро инкишоф намедиҳанд, аз ин рӯ табиб намехост онро истисно кунад.

Духтури Карни MRI-и мағзи сарашро фармоиш дод, санҷиши пурраи хун барои санҷиши камхунӣ, санҷишҳои хун барои баҳодиҳии фаъолияти ҷигар ва гурдаҳо ва санҷишҳои иловагӣ барои тасдиқ ё рад кардани бемории SLE ё Лайме. Натиҷаҳои санҷиши ӯ ҳам бо SLE ва ҳам ALS мувофиқат намекарданд ва натиҷаи санҷиш, ки антителоҳои бемории Лаймеро ҷустуҷӯ мекард, “мубтакилона” буд, ки “беэътибор” буд. Духтури Карни ALS ва SLE -ро истисно карда, қарор кард, ки санҷишҳои иловагӣ барои бемории Lyme гузаронад.

  • Чаро духтури Карни то ҳол бемории Лаймро гумонбар мекунад, ҳатто агар натиҷаҳои санҷиш антителоҳои Лаймаро дар хун муайян накунанд?
  • Кадом намуди санҷиши молекулавӣ метавонад барои муайян кардани антиденаҳои хун ба бемории Lyme истифода шавад?

Мо дар саҳифаҳои минбаъда ба намунаи Карни бармегардем.


Маркерҳои ДНК: Таъриф, хосиятҳо ва барномаҳо

Он аломатҳоеро, ки ба осонӣ шинохтан мумкин аст, аломатҳои маркер меноманд. Ҳар як унсури генетикӣ (локус, аллел, пайдарпаии ДНК ё хусусияти хромосома), ки бо фенотип, усулҳои ситологӣ ё молекулавӣ ба осонӣ муайян карда мешавад ва ҳангоми пайгирии сегменти хромосома ё хромосома ҳангоми таҳлили генетикӣ истифода мешавад.

Маркерҳои марбут ба тағирёбии порчаҳои ДНК, ки тавассути ферментҳои маҳдудкунандаи эндонуклеаза тавлид мешаванд, маркерҳои ДНК ё маркерҳои генетикӣ номида мешаванд.

Баъзе таърифҳои дигари аломатҳои ДНК дар зер оварда шудаанд:

i. Ҳама гуна пайдарпаии беназири ДНК, ки метавонад дар гибридизатсияи ДНК, ПТР ё таҷрибаҳои харитасозии маҳдудият барои муайян кардани ин пайдарпаӣ истифода шавад, маркери ДНК номида мешавад.

ii. Ген ё пайдарпаии ДНК, ки дар хромосома ҷойгиршавии маълум дорад ва бо як ген ё аломати мушаххас алоқаманд аст, ба нишони ДНК ишора мекунад.

Нишондиҳандаҳо аз чор намуд иборатанд, аз ҷумла:

Инҳо ба таври мухтасар баррасӣ мешаванд:

i. Морфологӣ:

Дар парвариши растаниҳо маркерҳоеро, ки бо тағирёбии шакл, андоза, ранг ва сатҳи қисмҳои гуногуни растанӣ алоқаманданд, маркерҳои морфологӣ меноманд. Чунин маркерҳо ба локусҳои мавҷудаи генҳо ишора мекунанд, ки ба морфологияи растанӣ таъсири равшан доранд. Дар бисёр намудҳои растаниҳо генҳо, ки ба шакл, ранг, безурётии мардон ё муқовимат таъсир мерасонанд, таҳлил карда шудаанд.

Дар биринҷ намунаҳои ин навъи нишонаҳо метавонанд мавҷудият ё набудани соя, ранги ғилофи барг, баландӣ, ранги дона, хушбӯй ва ғайраро дар бар гиранд. Дар зироатҳои хуб тавсифшуда ба монанди ҷуворимакка, помидор, нахӯд, ҷав ё гандум, даҳҳо ва ҳатто садҳо Чунин генҳо ба хромосомаҳои гуногун таъин карда шудаанд.

Якчанд камбудиҳои нишонаҳои морфологӣ мавҷуданд, ки дар зер оварда шудаанд:

а. Онҳо одатан дар марҳилаи рушди организм ифода мекунанд. Аз ин рӯ, муайян кардани онҳо аз марҳилаи рушди организм вобаста аст.

б. Онҳо одатан бартарият нишон медиҳанд.

в. Баъзан онҳо таъсири манфиро нишон медиҳанд.

г. Онҳо плеотропияро нишон медиҳанд.

f. Онҳо полиморфизмро камтар нишон медиҳанд.

g. Онҳо ба омилҳои муҳити зист таъсири сахт мерасонанд.

Маркерҳое, ки ба тағирёбии сафедаҳо ва шакли бандбандии аминокислотаҳо алоқаманданд, ҳамчун маркерҳои биохимиявӣ маълуманд. Ген сафедаеро рамзгузорӣ мекунад, ки онро метавон истихроҷ ва мушоҳида кард, масалан, изозимҳо ва сафедаҳои нигоҳдорӣ.

iii. Цитологӣ:

Маркерҳое, ки ба тағирёбии шумораи хромосомаҳо, шакл, андоза ва шакли банд алоқаманданд, маркерҳои ситологӣ номида мешаванд. Ба ибораи дигар, он ба бандинги хромосомӣ, ки бо доғҳои гуногун тавлид шудааст, ишора мекунад, масалан, бандинги G.

Ген ё дигар порчаи ДНК, ки ҷойгиршавии он дар геном маълум аст, нишондиҳандаи ДНК номида мешавад. Ин як беҳамто (пайванди ДНК) аст, ки дар наздикии ген ё макони таваҷҷӯҳ ба вуҷуд меояд. Он ба ҳама гуна пайдарпаии беназири ДНК дахл дорад, ки онро дар гибридизатсияи ДНК, ПТР ё харитасозии харитасозии маҳдудият барои муайян кардани ин пайдарпаӣ истифода бурдан мумкин аст.

Онро бо як қатор усулҳои молекулавӣ, аз қабили RFLPs, RAPDs, AFLP, SNPs, SCARs, microsatellites ва ғайра муайян кардан мумкин аст.

Нишондиҳандаҳои ДНК инчунин ҳамчун маркерҳои молекулавӣ ё маркерҳои генетикӣ маълуманд. Барои бартараф кардани мушкилоте, ки бо маркерҳои морфологӣ алоқаманданд, маркерҳои ба ДНК асосёфта таҳия карда шудаанд. Афзалиятҳои маркерҳои ДНК дар зер оварда шудаанд.

а. Онҳо хеле полиморфӣ мебошанд.

б. Онҳо мероси оддӣ доранд (аксар вақт ко-доминант).

в. Онҳо ба таври фаровон дар тамоми геном пайдо мешаванд.

г. Уларни аниқлаш осон ва тез.

д. Онҳо ҳадди аққал таъсири плеотропӣ нишон медиҳанд.

Ташхиси онҳо аз марҳилаи рушди организм вобаста нест.

Хусусиятҳои маркери ДНК:

Нишондиҳандаи идеалии ДНК бояд дорои баъзе хусусиятҳо ё хусусиятҳо бошад.

Хусусиятҳои муҳими нишондиҳандаи идеалии ДНК дар зер оварда шудаанд:

i. Полиморфизм:

Нишондиҳандаҳо бояд сатҳи баланди полиморфизмро нишон диҳанд. Ба ибораи дигар, дар нишонаҳо бояд тағирот вуҷуд дошта бошад. Он бояд фарқиятҳои ченшавандаро дар ифодаи байни намудҳои аломатҳо ва/ё генҳои манфиатдор нишон диҳад.

Нишондиҳанда бояд ҳамоҳанг бошад. Ин маънои онро дорад, ки бояд таъсири мутақобилаи дохили локус вуҷуд надошта бошад. Он дар муайян кардани гетерозиготҳо аз гомозиготҳо кӯмак мекунад.

iii. Мулти-аллелӣ:

Нишондиҳанда бояд бисёр аллеликӣ бошад. Ин барои ба даст овардани тағирёбии бештар/ полиморфизм барои як аломат муфид аст.

iv. Эпистаз нест:

Бояд набудани эпистаз вуҷуд дошта бошад. Он муайянкунии ҳама фенотипҳоро (гомо- ва гетерозиготҳо) осон мекунад.

Нишондиҳанда бояд бетараф бошад. Иваз кардани аллелҳо дар макони маркер набояд фенотипи шахсро тағир диҳад. Ин хосият қариб дар ҳама маркерҳои ДНК мавҷуд аст.

vi. Таъсири муҳити зист:

Нишондиҳандаҳо бояд ба муҳити зист ҳассос бошанд. Ин амвол инчунин қариб дар ҳама маркерҳои ДНК мавҷуд аст.

Барномаҳои ДНК дар такмили зироат:

Нишондиҳандаҳои ДНК дар такмили зироат якчанд барномаҳои муфид доранд.

Барномаҳои муҳим ба таври зерин номбар шудаанд:

i. Нишондиҳандаҳои ДНК дар арзёбии гуногунии генетикӣ дар гермплазма, навъҳо ва маводи пешрафтаи зотпарварӣ муфид мебошанд.

ii. Маркерҳои ДНК метавонанд барои сохтани харитаҳои пайванди генетикӣ истифода шаванд.

iii. Нишондиҳандаҳои ДНК дар муайян кардани аллелҳои нави муфид дар germplasm ва намудҳои ваҳшии растаниҳои зироат муфид мебошанд.

iv. Нишондиҳандаҳои ДНК дар интихоби ёридиҳандаи маркер истифода мешаванд. СМваА нисбат ба интихоби рост бартариҳои зиёд дорад.


Серология: Шарҳи мухтасар

Дигар моеъҳои бадан

Профили ДНК дар доираи васеи моеъҳо ва бофтаҳои бадан бомуваффақият анҷом дода шудааст, ки барои онҳо санҷишҳои умумӣ вуҷуд надоранд. Мисолҳо пӯст (аз ҷумла мӯйсафед), арақ, луоби бинӣ, чирк, шири сина ва муми гӯшро дар бар мегиранд. Дар аксари мавридҳо, пайдоиши биологӣ дар ин ҳолатҳо аз намуди мавод ё ҷойгиршавии он дар ашёи санҷидашуда, масалан, арақ аз бандҳои кулоҳ, луоби бинӣ дар бофтаҳо ва ғайра муайян карда мешавад. Барои муайян кардани шахсияти ҳуҷайравии ин маводҳо каме озмоишҳои мушаххас вуҷуд надоранд, аммо ҳар яки онҳо дорои биохимияи хосианд, ки ҳангоми зарурат барои таҳияи санҷиши идентификатсионӣ метавон истифода бурд.


Дур аз махсус: Тафовутҳои ночизи ДНК-и инсоният дар олами ҳайвонот “миёна” мебошанд

Таҳқиқоти имрӯза, "Чаро бояд митохондрия намудҳоро муайян кунад?" ҳамчун мақолаи дастрас дар маҷалла нашр шудааст Эволютсияи инсон, ба кори қаблии докторҳо такя мекунад. Стоекл ва Тайер, аз ҷумла санҷиши гуногунии генетикии митохондриалии одамон бо наздиктарин хешовандони зинда ва нобудшудаи мо. Миқдори гуногунии рангҳо дар ҳар як қуттии сурхи диаграммаи Кли нишон медиҳад, ки гуногунии митохондриалӣ дар байни шимпанзеҳо ва бонобоҳо нисбат ба одамони зинда хеле бештар аст. Кредит: Донишгоҳи Рокфеллер

Тадқиқотчиён пас аз омӯзиши ДНК -и митохондрия аз тақрибан 5 миллион намунае, ки тақрибан 100,000 намуди ҳайвонотро дар бар мегиранд, дар бораи эволютсияҳои муҳим дар бораи эволютсия хабар медиҳанд.

Тадқиқотчиёни Донишгоҳи Рокфеллер дар Ню-Йорк ва Биозентрум дар Донишгоҳи Базели Швейтсария дар бораи истихроҷи "маълумоти калон" аз пойгоҳи додаҳои генетикии босуръат рушдёбандаи ҷаҳон ва баррасии як адабиёти калон дар назарияи эволютсия, имрӯз чанд хулоса дар маҷалла нашр карданд. Эволютсияи инсон. Дар байни онҳо:

  • Аз нуқтаи назари гуногунии генетикӣ, 7,6 миллиард одами Замин дар олами ҳайвонот чизи махсусе нест. The tiny average genetic difference in mitochondrial sequences between any two individual people on the planet is about the same as the average genetic difference between a pair of the world's house sparrows, pigeons or robins. The typical difference within a species, including humans, is 0.1% or 1 in 1,000 of the "letters" that make up a DNA sequence.
  • Genetic variation—the average difference in mitochondria DNA between two individuals of the same species—does not increase with population size. Because evolution is relentless, however, the lack of genetic variation offers insights into the timing of a species' emergence and its maintenance.
  • The mass of evidence supports the hypothesis that most species, be it a bird or a moth or a fish, like modern humans, arose recently and have not had time to develop a lot of genetic diversity. The 0.1% average genetic diversity within humanity today corresponds to the divergence of modern humans as a distinct species about 100,000—200,000 years ago—not very long in evolutionary terms. The same is likely true of over 90% of species on Earth today.
  • Genetically the world "is not a blurry place." Each species has its own specific mitochondrial sequence and other members of the same species are identical or tightly similar. The research shows that species are "islands in sequence space" with few intermediate "stepping stones" surviving the evolutionary process.

Among 1st "big data" insights from a growing collection of mitochondrial DNA

"DNA barcoding" is a quick, simple technique to identify species reliably through a short DNA sequence from a particular region of an organism. For animals, the preferred barcode regions are in mitochondria—cellular organelles that power all animal life.

The new study, "Why should mitochondria define species?" relies largely on the accumulation of more than 5 million mitochondrial barcodes from more than 100,000 animal species, assembled by scientists worldwide over the past 15 years in the open access GenBank database maintained by the US National Center for Biotechnology Information.

The researchers have made novel use of the collection to examine the range of genetic differences within animal species ranging from bumblebees to birds and reveal surprisingly minute genetic variation within most animal species, and very clear genetic distinction between a given species and all others.

"If a Martian landed on Earth and met a flock of pigeons and a crowd of humans, one would not seem more diverse than the other according to the basic measure of mitochondrial DNA," says Jesse Ausubel, Director of the Program for the Human Environment at The Rockefeller University, where the research was led by Senior Research Associate Mark Stoeckle and Research Associate David Thaler of the University of Basel, Switzerland.

"At a time when humans place so much emphasis on individual and group differences, maybe we should spend more time on the ways in which we resemble one another and the rest of the animal kingdom."

Says Dr. Stoeckle: "Culture, life experience and other things can make people very different but in terms of basic biology, we're like the birds."

The study results represent a surprise given predictions found in textbooks, and based on mathematical models of evolution, that the bigger the population of a species, the greater the genetic variation one expects to find. In fact, the mitochondrial diversity within 7.6 billion humans or 500 million house sparrows or 100,000 sandpipers from around the world is about the same.The paper notes, however, that evolution is relentless, that species are always changing, and, therefore, the degree of variation within a given species offers a clue into how long ago it emerged distinctly -- in other words, the older the species the greater the average genetic variation between its members. Credit: The Rockefeller University

"By determining the genetic variety within species of the animal kingdom, made possible only recently by the burgeoning number of DNA sequences, we've documented the absence of human exceptionalism."

Says. Dr. Thaler: "Our approach combines DNA barcodes, which are broad but not deep, from the entire animal kingdom with more detailed sequence information available for the entire mitochondrial genome of modern humans and a few other species. We analyzed DNA barcode sequences from thousands of modern humans in the same way as those from other animal species."

"One might have thought that, due to their high population numbers and wide geographic distribution, humans might have led to greater genetic diversity than other animal species," he adds. "At least for mitochondrial DNA, humans turn out to be low to average in genetic diversity."

"Experts have interpreted low genetic variation among living humans as a result of our recent expansion from a small population in which a sequence from one mother became the ancestor for all modern human mitochondrial sequences," says Dr. Thaler.

"Our paper strengthens the argument that the low variation in the mitochondrial DNA of modern humans also explains the similar low variation found in over 90% of living animal species—we all likely originated by similar processes and most animal species are likely young."

Genetic variation does not increase with population

The study results represent a surprise given predictions found in textbooks, and based on mathematical models of evolution, that the bigger the population of a species, the greater the genetic variation one expects to find.

"Is genetic diversity related to the size of the population?" asks Dr. Stoeckle. "The answer is no. The mitochondrial diversity within 7.6 billion humans or 500 million house sparrows or 100,000 sandpipers from around the world is about the same."

The paper notes, however, that evolution is relentless, that species are always changing, and, therefore, the degree of variation within a given species offers a clue into how long ago it emerged distinctly—in other words, the older the species the greater the average genetic variation between its members.

Genetically, 'the world is not a blurry place.' It is hard to find 'intermediates' -- the evolutionary stepping stones between species. The intermediates disappear. The research is a new way to show that species are 'islands in sequence space.' Each species has its own narrow, very specific consensus sequence, just as our phone system has short, unique numeric codes to tell cities and countries apart. Credit: The Rockefeller University

Evolutionary bottlenecks: the fresh new beginning of a species

While asteroids and ice ages have played major roles in evolutionary history, scientists speculate that another great driver may have been the microbial world, notably viruses, which periodically cull populations, leaving behind only those able to survive the deadly challenge.

"Life is fragile, susceptible to reductions in population from ice ages and other forms of environmental change, infections, predation, competition from other species and for limited resources, and interactions among these forces," says Dr. Thaler. Adds Dr. Thaler, "The similar sequence variation in many species suggests that all of animal life experiences pulses of growth and stasis or near extinction on similar time scales."

"Scholars have previously argued that 99% of all animal species that ever lived are now extinct. Our work suggests that most species of animals alive today are like humans, descendants of ancestors who emerged from small populations possibly with near-extinction events within the last few hundred thousand years."

'Islands in sequence space'

Another intriguing insight from the study, says Mr. Ausubel, is that "genetically, the world is not a blurry place. It is hard to find 'intermediates' - the evolutionary stepping stones between species. The intermediates disappear."

Dr. Thaler notes: "Darwin struggled to understand the absence of intermediates and his questions remain fruitful."

"The research is a new way to show that species are 'islands in sequence space.' Each species has its own narrow, very specific consensus sequence, just as our phone system has short, unique numeric codes to tell cities and countries apart."

Adds Dr. Thaler: "If individuals are stars, then species are galaxies. They are compact clusters in the vastness of empty sequence space."

The researchers say that with the bones or teeth of an ancient hominid, like those found in southern France or northern Spain, scientists might shed further light on the rate of evolution of the human species.

"It would be very exciting if over the next few years physical anthropologists and others were able to compare mitochondrial DNA from hominid species over the last 500,000 years," says Dr. Stoeckle.


Which Came First?

There is some evidence DNA may have occurred first, but most scientists believe RNA evolved before DNA.   RNA has a simpler structure and is needed in order for DNA to function. Also, RNA is found in prokaryotes, which are believed to precede eukaryotes. RNA on its own can act as a catalyst for certain chemical reactions.

The real question is why DNA evolved if RNA existed. The most likely answer for this is that having a double-stranded molecule helps protect the genetic code from damage. If one strand is broken, the other strand can serve as a template for repair. Proteins surrounding DNA also confer additional protection against enzymatic attack.


Genetically Modified Organisms

A genetically modified organism (GMO) is any organism whose genetic material has been altered using genetic engineering techniques. GMOs are a source of medicines and genetically modified foods and are also widely used in scientific research, along with the production of other goods.
Genetic modification involves the mutation, insertion, or deletion of genes. Inserted genes usually come from a different species in a form of horizontal gene-transfer.

Тасвири (PageIndex<1>): Glo Fish: The GloFish is a patented and trademarked brand of genetically modified (GM) fluorescent fish. A gene that encodes the green fluorescent protein, originally extracted from a jellyfish, that naturally produced bright green fluorescence was inserted into a zebrafish embryo.

Бактерияҳо, наботот ва ҳайвонот аз аввали солҳои 70 -ум барои мақсадҳои таълимӣ, тиббӣ, кишоварзӣ ва саноатӣ аз ҷиҳати генетикӣ тағйир дода шудаанд. In the US, GMOs such as Roundup-Ready soybeans and borer-resistant corn are part of many common processed foods. As in many of these biotechnology areas there is considerable controversy in the use of GMOs.


Видеоро тамошо кунед: Дар Душанбе аз 18 октябри соли 2021 расман мавсими нави гармидиҳӣ оғоз гардид (Январ 2022).