Маълумот

7.5: Андозагирии ҳассосияти маводи мухаддир - Биология

7.5: Андозагирии ҳассосияти маводи мухаддир - Биология


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

7.5: Андозагирии ҳассосияти маводи мухаддир

Ҳассосияти маводи мухаддири ҳуҷайраҳои саратон бо тағирёбии суръати ҷамъшавии омма пешбинӣ шудааст

Таҳлилҳое, ки метавонанд вокуниши ҳуҷайраҳои варамро ба табобати саратон муайян кунанд, метавонанд дар интихоби реҷаи дору барои беморони алоҳида кӯмак расонанд. Бо вуҷуди ин, фоиданокии таҳлилҳои функсионалии ҷорӣ маҳдуд аст ва биомаркерҳои пешгӯии генетикӣ танҳо барои як қисми ками табобати саратон дастрасанд. Мо дарёфтем, ки суръати ҷамъшавии оммавии як ҳуҷайра (MAR), ки дар тӯли чанд соат бо резонатори микроканалии боздошташуда ҳассосияти дору ё муқовимати глиобластома ва ҳуҷайраҳои лейкемияи шадиди лимфоцитии В-ро дақиқ муайян кардааст. MAR гетерогении ҳассосияти маводи мухаддирро на танҳо дар байни варамҳои гуногун, балки дар дохили варамҳои инфиродӣ ва хатҳои ҳуҷайраҳои аз варам ҳосилшуда ошкор кард. Андозаи MAR вокуниши маводи мухаддирро бо истифода аз намунаҳои то 25 мкл хуни периферӣ ҳангоми нигоҳ доштани қобилияти ҳуҷайра ва мутобиқат бо тавсифи поёноб пешгӯӣ мекард. Андозагирии MAR як усули умедбахш барои мустақиман санҷидани вокунишҳои терапевтии як ҳуҷайра ва муайян кардани зерпопулясияҳои ҳуҷайра бо муқовимати фенотипӣ дар омосҳои гетерогенӣ мебошад.


Реферат

Аз ҳад зиёд экспрессияи хамиртуруши интиқолдиҳандаи кассетаи ATP-и Pdr5 боиси муқовимати плейотропии дору ба пайвастагиҳои гуногуни ситотоксикии сохторӣ мегардад. Барои муайян кардани пасмондаҳои Pdr5, ки дар шинохти субстрат ва / ё интиқоли маводи мухаддир иштирок мекунанд, мо маҷмӯи мутагенези тасодуфии in vitro ва скрининги фенотипиро барои ҷудо кардани интиқолдиҳандагони нави мутант Pdr5 бо хусусияти тағирёфтаи субстрат истифода кардем. Китобхонаи плазмиди дорои мутагении тасодуфӣ PDR5 генҳо ба ҳуҷайраҳои мувофиқи хамиртуруши ҳассос ба дору табдил дода шуданд ва пас аз интихоби фенотипии мутантҳои Pdr5. Интиқолдиҳандагони интихобшудаи мутант Pdr5 аз рӯи сатҳҳои экспрессия, локализатсияи зерҳуҷайраҳо, профилҳои муқовимати маводи мухаддир ба сиклогексид, родаминҳо, азолҳои зидди fungal, стероидҳо ва ҳассосият ба ингибитори FK506 таҳлил карда шуданд. пайдарпайии ДНК шаш PDR5 генҳои мутант аминокислотаҳоеро, ки барои шинохти субстрат, интиқоли маводи мухаддир ва монеаи мушаххаси интиқолдиҳандаи Pdr5 муҳиманд, муайян карданд. Мутацияҳо дар ҳар як доменҳои пайвасткунандаи нуклеотидҳо, доменҳои трансмембранаи 10 ва аз ҳама тааҷубовар ҳатто дар ҳалқаҳои пешгӯишудаи гидрофилии берун аз ҳуҷайра пайдо шуданд. Ҳадди ақал баъзе мутатсияҳои нуқтаҳое, ки муайян карда шудаанд, ба қабати Pdr5 таъсир мерасонанд ва аз он шаҳодат медиҳанд, ки сохтори қатшуда як муайянкунандаи асосии хосияти субстрат мебошад. Тааҷҷубовар аст, ки мубодилаи S1360F дар домени трансмембрании 10 на танҳо боиси мушаххасии маҳдуди субстрат гардид, балки инчунин ҳассосияти Pdr5-ро ба ҷилавгирӣ аз иммуносупрессант FK506 бекор кард. Ин аввалин гузориши мутатсия дар як интиқолдиҳандаи кассетаи ATP-и хамиртурушест, ки имкон медиҳад, ки интиқоли субстрат ва ҳассосияти ингибиторҳо ҷудо карда шавад.


Муҳокима

Дар ин таҳқиқот, мо ба таври мунтазам функсияи эҳтимолии бозёфтҳои GWAS-ро, ки ба фенотипҳои фармакологӣ алоқаманданд, арзёбӣ кардем ва ҷойгиршавии физикии SNP-ҳои бо ин фенотипҳо алоқамандро арзёбӣ кардем. Дар доираи васеи доруҳои зидди саратон, SNP-ҳои бо фенотипҳои фармакологӣ алоқаманд эҳтимоли бемаънӣ, нодуруст ё чаҳорчӯбаи SNP-ҳо набуданд ва онҳо дар дохили пайвандҳо ё дар 3′UTRҳо набуданд. Эҳтимолияти SNP-ҳо бо сатҳи ифодаи генҳо (ҳамчун eQTLs) алоқаманданд ва ғанисозӣ барои SNP-ҳои бо 10 ё зиёда хислатҳои экспрессияи генҳо алоқаманд бештар зоҳир мешавад (танзимгари усто номида мешавад). Натиҷаҳои ин бозёфтҳо дар онанд, ки "функсия" -и SNP -ҳо, ки бо фенотипҳои фармакологии доруҳои зидди саратон алоқаманданд, метавонанд натиҷаи нақши онҳо дар танзими ифодаи генҳо бошанд. Ғайр аз он, барҷастаи SNP-ҳои интронӣ ё интергенӣ, ки бо дигар GWAS-ҳои аксуламали маводи мухаддир алоқаманданд (1, 23) эҳтимолияти истифодаи ин мушоҳидаро ба таври васеъ ба вуҷуд меорад. Ба ибораи дигар, ҳассосияти шахс ба таъсири фармакологии маводи мухаддир метавонад аз фарқиятҳои нозук дар сатҳи ифодаи бисёр генҳо вобаста бошад. Гарчанде, ки тадқиқоти мазкур худро ба ҳолати мушаххаси агентҳои химиотерапевтӣ маҳдуд мекунад, равиши дар ин ҷо шарҳ додашуда барои таҳқиқи ғанисозии функсионалӣ метавонад дар дигар контекстҳои фармакогеномӣ ё дигар хусусиятҳои мураккаб истифода шавад. Масалан, мо ғанисозии eQTL-ро дар SNP-ҳои марбут ба ҳассосият аз GWAS-ҳои гуногун мушоҳида кардем (24). Аз ин рӯ, истифодаи иттилооти ифода бояд воситаеро барои муайян ва тавсифи шумораи бештари локусҳои саҳмгузор ва муайян кардани функсияҳои асосии фармакологӣ, ки аз омилҳои хатари генетикӣ таъсир мерасонанд, таъмин намояд.

GWASs зуд ба як усули стандартӣ барои кашфи вариантҳои генетикии марбут ба беморӣ, вокуниши маводи мухаддир ё дигар фенотипҳо табдил ёфтанд. Гарчанде ки GWAS бартарии баҳодиҳии ҳамаҷонибаи геномро бидуни ғаразнок пешниҳод мекунад, мушкилии бузургтарин бо равиши GWAS дарёфти сигналҳои мусбати ҳақиқӣ дар байни садо мебошад. Аксар вақт ба таҳлиле, ки мумкин аст аз таҳқиқоти генҳои номзад ба вуҷуд омадааст, ғаразе ворид мешавад, ки эҳтимолан SNP -ҳои функсионалӣ ё сабабӣ онҳое ҳастанд, ки дар як ген ё дар наздикии он ҷойгиранд. Дар асл, як қатор GWASҳо мавҷуданд, ки бо ин фарзия бо маҳдуд кардани арзёбӣ танҳо SNP-ҳои дар ин минтақаҳо ҷойгиршуда оғоз мешаванд (9, 17) ва ба ин васила аксарияти куллии SNPҳоро нодида мегиранд, танҳо 2% геноми инсон аз генҳо иборат аст (25). ). Натиҷаҳои мо албатта бар зидди ин ғараз баҳс мекунанд ва SNP -ро дар тамоми геном, хусусан онҳое, ки бо ифода алоқаманданд, эҳтимолан муҳим меҳисобанд. Ғайр аз он, ворид кардани иттилооти eQTL барои тавсифи локусҳои марбут ба фенотипҳои фармакологӣ назари умумиро дар бораи он, ки SNP метавонад ба ҳассосияти маводи мухаддир таъсир расонад, мусоидат мекунад. (Масалан, нигаред ба расми 5 ва расми S1 барои тасвири он, ки чӣ гуна SNP rs1649942 бо цисплатин ва карбоплатин алоқаманд метавонад ба ҳассосияти ҳуҷайра ба ин доруҳои платинатсия тавассути таъсири он таъсир расонад. транс-амалкунанда eQTL, дар ифодаи генҳои мухталифе, ки дар тамоми геном ҷойгиранд.)

Тадқиқотчиён бо мақсади ҳисоб кардани қисми зиёди мероси гумшуда дар аломатҳои мураккаб, муҳаққиқон кӯшишҳоро барои муайян кардани вариантҳои нодир равона карданд. Ба наздикӣ, Голдштейн ва ҳамкасбон (26) пешниҳод карданд, ки вариантҳои нодир, вале ошкорнашуда дар ассотсиатсияҳо бо вариантҳои умумӣ дар GWASs гирифта шудаанд. Ин вариантҳои ба истилоҳ нодир дар “ассотсиатсияи синтетикӣ” қарор доранд, то ки вариантҳои умумӣ воқеан ба вариантҳои нодир бо гузариши баланд, ки ба ҳассосияти беморӣ ва фенотипҳои дигар таъсир мерасонанд, ишора мекунанд. Мавҷудият ва аҳамияти ин ассотсиатсияҳои синтетикӣ дар генетикаи аломатҳои мураккаб бояд тафтиш карда шаванд. Кӯшишҳо ба монанди Лоиҳаи 1000 геном (http://www.1000genomes.org) эҳтимолан маълумоти арзишмандро дар бораи ин вариантҳои нодир тавлид хоҳанд кард, ки имкон медиҳад, ки саҳми онҳо дар хислати фенотипӣ таҳлил карда шавад. Бо вуҷуди ин, тадқиқоти мазкур чаҳорчӯбаи функсионалӣ барои таҳқиқи биологияи вокуниш ба маводи мухаддир ва механизми потенсиалӣ байни ассотсиатсияҳои генотип ва фенотипро фароҳам меорад. Мумкин аст, ки баъзе аз ҳассосияти доруҳои кимиётерапевтии мо бо SNP-ҳои алоқаманд ба вариантҳои нодири “сабабӣ” ишора кунанд, аммо ин имкон ба мушоҳидаи ибтидоии мо таъсир намерасонад, ки SNP-ҳои ҳассосияти кимиётерапевтикии марбут ба маводи мухаддир дар eQTL ғанӣ шудаанд. Ғайр аз он, дар муқоиса бо равиши мо, мафҳуми ассотсиатсияи синтетикӣ барои ассотсиатсияҳои мушоҳидашуда шарҳи биологӣ намедиҳад. Ниҳоят, бо афзоиши шумораи вариантҳои эҳтимолӣ, такони баррасии eQTL-ҳо барои муайян кардан ва афзалият додани SNP-ҳои алоқаманд боз ҳам бештар мешавад.

GWAS-ҳои ҷорӣ барои муайян кардани ассотсиатсияҳо дар басомадҳои аллелии паст қудрати нисбатан кам доранд. Бо назардошти андозаи намунаи мо, тадқиқоти мо барои арзёбии SNP-ҳо бо камтар аз 5% MAF барои нақши онҳо ҳамчун eQTL ё робитаи онҳо бо ҳассосияти химиотерапевтӣ қобилият надорад. Дар намунаҳои HapMap CEU 398,086 SNP-ҳои нодир (MAF <5%) мавҷуданд, ки ба таҳлили ҳамаҷонибаи ҳозираи мо дохил карда нашудаанд. Аз ин SNP-ҳои нодир, 3,182 полиморфизмҳои нодуруст мебошанд, ки 0,8% SNP-ро дар ин қуттии MAF ташкил медиҳанд. (Дар маҷмӯъ 2,3 миллион SNP дар намунаҳои HapMap CEU ба таҳлили ҳамаҷонибаи мо дохил карда шуданд, ки бо зиёда аз 11,000 полиморфизмҳои нодуруст дохил карда шудаанд.) Тавре интизор мерафт, ҳиссаи рамзгузории SNP дар қуттии MAF-и нодир тақрибан ду маротиба зиёдтар аз намунаҳои маъмулӣ аст. Қуттиҳои MAF (MAF >5%). Эҳтимол дорад, ки саҳми кодгузории SNP -ҳо (дар баробари eQTLs) ба варианти фенотипӣ афзоиш хоҳад ёфт, агар SNP -ҳои нодир дохил карда шаванд. Бо вуҷуди ин, ин бояд пурра арзёбӣ карда шавад. Бо вуҷуди ин, тадқиқоти мо ба таври возеҳ нишон медиҳад, ки SNP-ҳои ба ҳассосияти доруҳои кимиётерапевтӣ алоқаманд бо вариантҳои умумии рамзгузорӣ бой намешаванд.

Усули дигари маъмул барои афзалият додани генҳо ва муайян кардани эҳтимолияти "сигналҳои ҳақиқӣ" аз GWAS ин истифодаи усулҳои оморӣ мебошад. Метанализ (ассотсиатсияҳои омехта дар саросари GWASs) метавонанд барои ҷамъоварии иттилоот аз якчанд GWASs барои баланд бардоштани имконияти пайдо кардани мусбатҳои ҳақиқӣ истифода шаванд [27]. Баръакс, маълумоти мо нишон медиҳад, ки тавзеҳ додани SNPҳо бо маълумот дар бораи ифода пеш аз GWAS метавонад воситаи коҳиш додани санҷишҳои сершумор ва фарқ кардани он ассотсиатсияҳое бошад, ки алоқамандии биологӣ доранд. Яке метавонад ба назар гирифта шавад, ки SNP-ҳоро дар дохили генҳо ё наздики генҳо дар якҷоягӣ бо eQTL-ҳо барои таҳлил истисно накунанд, то SNP-ро, ки ба фаъолият ё сохтори сафеда таъсир мерасонанд, истисно накунанд.

Ҷолиб он аст, ки дараҷаи ғанисозии eQTL (аз ғанисозии тақрибан аз 4 то 15 маротиба Ҷадвали 2) ба синфи маводи мухаддир хос аст. Баръакси ин, шумораи SNP-ҳо дар ҳар як синфи функсионалӣ, ки аз усули ба макон нигаронидашуда мебароянд, барои ҳама доруҳо монанд аст (масалан, Ҷадвали S1 муқоисаи агентҳои платинатсияро нишон медиҳад). Шаш доруеро, ки дар таҳқиқоти мазкур арзёбӣ шудаанд, метавон ба се синфи дору тақсим кард: агентҳои платинаторӣ (цисплатин, карбоплатин), ингибиторҳои топоизомераза (даунорубицин ва этопозид) ва антиметаболитҳо (ситарабин, капецитабин). Таҳлили ғанисозии мо нишон медиҳад, ки ингибиторҳои топоизомераза ғанитарии бештарро (13 то 54 маротиба) дар танзимгари усто нишон медиҳанд. Антиметаболитҳо ғанисозии пасттарини танзимгари асосиро нишон медиҳанд (аз ду то 3,5 маротиба) ва агентҳои платинизатсия ғанисозии сатҳи миёнаро (4,5 то 7,5 маротиба) нишон медиҳанд. Синфҳои маводи мухаддир, ки аз нуқтаи назари амали терапевтии молекулавӣ муайян карда шудаанд, аз рӯи холҳои ғанисозии функсионалӣ ба сатҳҳои ғанисозӣ ҷудо мешаванд, ки арзиши профили ғанисозии танзимгари магистрро барои тавсифи синфҳои маводи мухаддир пешниҳод мекунанд. Ҳоло мо нақши ин танзимгарони потенсиалиро дар муайян кардани амали синфи маводи мухаддир таҳқиқ карда истодаем.

Ниҳоят, ғанисозии мушоҳидашуда дар eQTLҳо ва танзимгарони магистр дар байни ҳассосияти доруҳои кимиётерапевтӣ бо SNP-ҳои алоқаманд устувор аст, яъне новобаста аз (ман) дараҷаи аҳамияти ассотсиатсияҳои генотип -фенотип, ки барои муайян кардани SNP -ҳои ҳассосияти химиотерапевтӣ истифода мешаванд (ii) ифода П ҳадди арзише, ки барои муайян кардани eQTLҳо истифода мешавад ва (iii) шумораи генҳое, ки аз ҷониби SNP танзим карда мешаванд. Ғайр аз он, таҳлили ғанисозии мо, ки мо анҷом додем, ба MAF шарт буд, то намунаи SNP-ҳои дар симулятсия истифодашуда ба таври номутаносиб аз ягон қуттии ягона дар MAF-и SNP-ҳои марбут ба маводи мухаддир, аз ҷумла поёни пасте, ки дар он GWAS мавҷуд аст, гирифта нашавад. қудрати кам барои ошкор кардани ассотсиатсияҳо.

Хулоса, гарчанде ки полиморфизмҳо, ки таркиби аминокислотаи сафедаҳоро тағир медиҳанд, номзадҳои табиӣ барои шарҳи тағирот дар фенотипи вокуниши доруҳо мебошанд, бозёфтҳои мо аҳамияти нисбии тағирёбии генетикиро, ки ба фаровонии транскрипт дар фаҳмондани детерминантҳои ҳассосияти ҳуҷайравӣ ба доруҳои химиотерапевтӣ таъсир мерасонанд, нишон медиҳанд. Вариантҳои генетикӣ, ки бо ҳассосияти маводи мухаддир ба як қатор агентҳои химиотерапевтӣ алоқаманданд, эҳтимоли бештари eQTL-ҳо дар муқоиса бо интизории тасодуфӣ мебошанд ва эҳтимоли бештари eQTL-ҳои марбут ба фенотипҳои экспрессияи генҳои сершумор мебошанд. Ин барои фаҳмидани минбаъдаи он, ки чӣ гуна тағирёбии генетикӣ ба фарқиятҳо дар посух ба агентҳои химиотерапевтӣ мусоидат мекунад ва метавонад ба дигар синфҳои маводи мухаддир татбиқ карда шавад, аҳамияти муҳим дорад.


Тағйирёбандаҳои хоси маводи мухаддир, ки метавонанд ба ним-ҳаёт таъсир расонанд

  • Формулаи маводи мухаддир (яъне, доруҳои тағирёфта ё назоратшавандаи таркиш мӯҳлати ним-ҳаётро дароз мекунанд)
  • Чӣ гуна дору дар бадан рафтор мекунад (яъне, тартиби сифр, тартиби якум ё фармакокинетикаи бисёрсоҳавӣ)
  • Тарзи ворид кардани маводи мухаддир (нисфи ҳаёти вентилятсия ҳангоми воридкунии интраназал ё даҳонӣ метавонад фарқ кунад)
  • Чӣ тавр маводи мухаддир аз бадан хориҷ карда мешавад (масалан, гурда, ҷигар, шуш)
  • Агар дору дар равған ё дигар намудҳои бофта ҷамъ шавад
  • Агар дору ба сафедаҳо пайваст бошад ё не
  • Мавҷудияти метаболитҳо ё дигар доруҳое, ки метавонанд бо ҳам таъсир расонанд
  • Хусусиятҳои маводи мухаддир, аз ҷумла андозаи молекула, заряд ва pKa
  • Ҳаҷми тақсимоти маводи мухаддир
  • Дигар тағирёбандаҳо, масалан, агар маводи мухаддир фаъолона интиқол дода шавад, худ ба вуҷуд омада бошад ё фармакокинетикаи қаноатбахш дошта бошад.

7.5: Андозагирии ҳассосияти маводи мухаддир - Биология

Лигазаи протеини биотини микобактерия (МтBPL) мубодилаи липидҳоро дар саросари ҷаҳон танзим мекунад Mtb тавассути биотинилизатсияи посттрансляционии ацил коэнзим А карбоксилазаҳо дар биосинтези липидҳо иштирок мекунанд, ки қадами аввалро дар биосинтези кислотаи равғанӣ катализ мекунанд ва коэнзими пируват карбоксилаза, ферменти глюконеогенӣ барои катаболизми липидҳо муҳиманд. Дар ин ҷо мо тарҳ, рушд ва арзёбии як ингибиторе, ки оқилона тарҳрезӣ шудааст МтBPL. Ин ингибитор ингибитори пурқуввати ферментҳои субнаномолярӣ ва фаъолияти зидди силро бар зидди маводи мухаддир тобовар ва ба таври васеъ муқовимат нишон медиҳад. Mtb штаммҳо. Мо нишон медиҳем, ки ингибитор дар vivo биотинилизатсияи сафедаи ферментҳои калидӣ, ки дар биосинтези кислотаи равғанӣ иштирок мекунанд, коҳиш медиҳад ва фаъолияти антибактериалӣ MtBPL вобаста аст. Ғайр аз он, генҳои рамзгузории BPL дар он муҳим дониста шуданд M. smegmatis. Ниҳоят, сохтори кокристалии рентгении ингибитор алоқаманд аст МтBPL бо фаҳмиши муфассал барои таҳлили минбаъдаи сохтор-фаъолият ҳал карда шуд. Дар маҷмӯъ, ин маълумотҳо аз он шаҳодат медиҳанд МтBPL ҳадафи умедбахш барои рушди минбаъдаи терапевтии зидди сил мебошад.

Реферати графикӣ

Нуктаҳои муҳим

► Ингибитори аз нав тарҳрезишудаи бисубстрат наздикии pM-ро нишон медиҳад Mtb ► Ингибитор фаъолияти селективии зиддитуберкуляриро нишон медиҳад ► Рамзгузории гении BPL нишон дода шудааст, ки дар M. smegmatis ► Сохтори кокристалии ингибиторе, ки ба BPL пайваст аст, ҳал карда шудааст


Хулосахо

Якҷоя, натиҷаҳои мо нишон медиҳанд, ки ТОП1 рақами нусхаи ген як нишондиҳандаи камбизоат барои вокуниши CPT дар хатҳои ҳуҷайраи милод аст. Барои тасдиқи ин гипотеза барои ҳар як зергурӯҳи саратони сина таҳқиқотҳои ҳамаҷониба лозиманд. Воқеан, барои хатҳои ҳуҷайра, ки аз зергурӯҳҳои HER2 ва Luminal гирифта шудаанд, маълумоти мо ба таносуби мустақими тахминии байни рақами нусхаи ген, фаъолияти TOP1 ва ҳассосияти ҳуҷайра ба CPT ишора мекунад, ки TOP1 дар сатҳи геномӣ ё ферментативӣ метавонад як аломати пешгӯӣ бошад. барои вокуниш ба CPT дар ин зергурӯҳҳои BC. Барои ҳама зергурӯҳҳои BC, робитаи мустақим байни суръати афзоиш ва аксуламали мобилӣ ба CPT вуҷуд дорад. Дар маҷмӯъ, натиҷаҳои мо нишон медиҳанд, ки омосҳои ашаддии хашмгинтар ва зуд тақсимшаванда метавонанд аз ҷониби CPT самараноктар мавриди ҳадаф қарор гиранд. Вокуниши бениҳоят пурқуввати хатҳои ҳуҷайраҳои аз варамҳои TNBC гирифташуда, ки бо CPT табобат карда мешаванд, умедбахш ба назар мерасад ва нишон медиҳад, ки шояд таҳқиқи имконияти табобати беморон бо ин зерсистемаи BC бо ҳосилаҳои CPT арзанда бошад.


МАВОД ВА УСУЛ

Нигоҳдории P. falciparum фарҳангҳо.

P. falciparum паразитҳо дар O + ҳуҷайраҳои сурхи хун дар муҳити RPMI 1640 (бе фенол сурх), ки дорои л -глутамин буда, бо 50 μg гентамицин/мл, 14 мг гипоксантин/литр, 38,4 мм HEPES, 0,2% бикарбонати натрий, 0,2% глюкоза (рН 7,2), 5% хунобаи инсон ва 0,25% Albumax II. Фарҳангҳо дар 5% гематокрит дар паразитемия аз 1 то 10% бо тағирёбии ҳаррӯзаи медиа нигоҳ дошта мешуданд (15). Ҳадди аққал ҳар 2 ҳафта хуни тоза гирифта мешуд ва фарҳангҳо дар зери 96% нитроген, 3% гази карбон ва 1% оксиген дар 37 ଌ нигоҳ дошта мешуданд.

Таҳлили пешгирии паҳншавии зиддималариалӣ (формати табақаи 384-чоҳ).

Қисмати 20-миллиенти муњити скринингї (муњити парвариш бе зардоби инсон, вале бо 0,5% Albumax II илова карда шудааст) тавассути диспенсери моеъи MicroFlo (BioTek) ба лавњањои тањлили 384-чоњи сиёњ ва равшани поёни (& # x003bcClear) GNF зарринҳои фармоишии Griener Bio-One). Сипас, қисмҳои 50-nl пайвастагиҳо дар формати вокуниш ба воя тавассути PlateMate Plus (Matrix) ё PinTool (GNF Systems) интиқол дода шуданд. Ҳар як штамми паразитҳо то 0.3% паразитемия ва 4.2% гематокрит омехта карда шуда (30 μl) бо истифода аз диспенсери моеъи MicroFlo ба плитаҳои таҳлили пешакӣ гармшуда тақсим карда мешавад. Паразитемияи ниҳоӣ ва гематокрит мутаносибан 0,3 ва 2,5% буд. Лавҳаҳои таҳлил дар 37ºC дар давоми 72 соат зери 96% нитроген, 3% гази карбон ва 1% оксиген инкубатсия карда шуданд. Пас аз 72 соат, омехтаи омодашудаи буфери лизис (5 мм EDTA, 1,6% Triton X-100, 20 mM Tris-HCl, 0,16% сапонин) дар об ва 0,1% реагенти детектории сабзи SYBR дар 10 ½ ба як чоҳ тақсим карда шуд. бо истифода аз MicroFlo. Фарҳангҳо барои 24 соати иловагӣ дар 25ºC пеш аз чен кардани шиддати флуоресцентсия бо истифода аз хонандаи Envision plate (Perkin-Elmer) бо оинаи 505 дихроӣ инкубатсия карда шуданд. Филтрҳои ҳаяҷонбахш ва эмиссия мутаносибан 485 ва 530 нм буданд. Маълумот дар асоси арзишҳои максималии сигнали флуоресцентӣ барои чоҳҳои бо диметилсулфоксид (DMSO) коркардшуда (бе монеаи пайвастагӣ) ва ҳадди ақали сигнали флуоресцент барои чоҳҳое, ки консентратсияи баландтарини пайвастагиҳои назорати ингибитор доранд, ба эътидол оварда шуданд. Консентратсияи ингибиторӣ 50% (IC50с) бо истифода аз модели каҷӣ бо регрессияи стандартии логистикӣ ба даст оварда шудаанд.

Таҳлили клиникии изолятсияи шизонти камолот.

Изолятҳои саҳроӣ аз минтақаи Мэ Соти музофоти Так (Таиланд) дар соли 2009 ҷамъоварӣ карда шуданд (10 P. vivax ва 13 P. falciparum) ва Тимика, Папуаи Ҷанубӣ (Индонезия), соли 2011 (20 P. vivax ва 26 P. falciparum). Ҳама намунаҳо аз беморони гирифтори бемории вараҷаи шадид (бо паразитемияи мононамуди аз 2000 то 10000 паразит/μl) буданд, ки дар клиникаҳои амбулаторӣ муроҷиат мекарданд. Пас аз гирифтани розигии хаттӣ, намунаҳои хун тавассути венепунксия дар найҳои гепаринизатсияшуда ҷамъоварӣ карда шуданд ва дар давоми 5 соати ҷамъоварӣ коркард карда шуданд. Тасдиқи ахлоқӣ барои ин лоиҳа аз ҷониби Кумитаи этикаи тадқиқоти инсонӣ, Мактаби тадқиқоти тандурустии Мензис, Дарвин, Австралия (HREC 2010-1396) Комиссияи тадқиқотии этикаи Эйкман, Ҷакарта, Индонезия (EIREC-47) Донишгоҳи Оксфорд, марказ барои ваксинологияи клиникӣ ва тибби тропикӣ, Подшоҳии Муттаҳида (XTREC 027-025) ва Кумитаи этикаи факултети тибби тропикӣ, Донишгоҳи Маҳидол, Бангкок, Таиланд (MUTM 2008-215). Намунаҳо бо 㺀% ҳалқаҳои барвақтӣ барои санҷиши ҳассосияти маводи мухаддир интихоб карда шуданд. Пас аз хориҷ кардани тромбоситҳо ва лейкоцитҳо, ҳассосияти маводи мухаддир ва фаъолияти мушаххаси марҳила тавре ки қаблан тавсиф шуда буд, озмоиш карда шуд [16, 17]. Сифати лавҳаи дору тавассути гузаронидани таҳлилҳои камолоти шизонт бо штамм ба хлорохин тобовар K1 ва штамм ба хлорохин ҳассос FC27 таъмин карда шуд. Каҷҳои вокуниш ба миқдор ва IC50 арзишҳо бо роҳи мувофиқ кардани маълумот ба ингибитори сигмоидалӣ ҳисоб карда шуданд Эмакс модели фармакодинамикӣ бо истифода аз WinNonLin (v4.1 Pharsight Corp.). Миёнаи IC50s ба таври ғайрипараметрӣ бо истифода аз санҷиши Kruskal-Wallis муқоиса карда шуданд. Таҳлилҳо ва графикаи оморӣ бо истифода аз нармафзори GraphPad Prism 5 (версияи 5) гузаронида шуданд.

P. falciparum камолоти гаметоцитҳо.

Фарҳангҳои NF54 дар системаи тамғагузор дар таваққуфи 5% ҳуҷайраҳои сурхи гурӯҳи 0 0 дар муҳити фарҳангӣ бо зичии паразитҳои ғайримуқаррарии 0,5% оғоз карда шуданд ва миёна ҳар рӯз иваз карда мешуд (18, �). Паразитҳои асексуалӣ ва гаметоцитҳо бо истифода аз плёнкаҳои хуни дар Гиемза олудашуда мунтазам назорат карда мешуданд. Дар рӯзи 8, ҳама фарҳангҳое, ки дорои 3 то 4% ҳуҷайраҳои сурхи сироятёфтаи асексуалӣ, 2.5% гаметоцитҳои марҳилаи II ва 2.4% марҳилаҳои гаметоцитҳои марҳилаи III/IV (гаметоцитемияи умумии 4,9%) мебошанд, ҷамъ карда шуданд. Усулҳои тозакунӣ барои нест кардани паразитҳои асексуалӣ бо мақсади пешгирии таъсири манфӣ ба камолоти гаметоцитҳо ва сироятёбӣ истифода намешаванд. Маҷмӯа аз рӯзҳои 8 то 12 бо иваз кардани миёна ду маротиба дар як рӯз илова карда шуд ва дар 48 соат пеш аз санҷиши стандартии ғизодиҳии мембрана (SMFA) бо муҳити назоратӣ иваз карда шуд. Миқдори гаметоситҳои баркамол дар рӯзи 13, инчунин қобилияти гаметоситҳои нарина барои хориҷшавӣ пас аз паст шудани ҳарорат ва илова кардани хунобаи гӯсолаи ҳомила муайян карда шуд (21). Фарҳангҳо бо гаметоцитҳои эксфлагелятсия ва/ё гаметоцитҳои баркамол дар SMFA ба хомӯшакҳо рӯзи 14 ғизо дода шуданд.

Санҷишҳои бастани интиқол.

SMFA барои санҷидани таъсири эҳтимолии пайвастагиҳо ё доруҳо ба спорогонияи паразит дар магас, тавре ки қаблан тавсиф шуда буд, истифода мешуд (22, 23). Ба таври мухтасар, фарҳангҳои 14-рӯзаи штамми NF54, ки аз 0,3 то 0,5% гаметоцитҳои баркамол доранд, аввал барои сифат ва потенсиали ташаккули ооцистҳо дар ғизои пешакии озмоишӣ ба магасҳои анофеле тафтиш карда шуданд. Вақте ки ookinetes 22 соат пас аз таъом дида шуданд, маводи парвариши паразитҳо барои санҷиши таъсири эҳтимолии пайвастагиҳо ба спорогония истифода шуд. Аввалан, 300 ½ маводи парвариш ба 180 ½ ҳуҷайраҳои бастабандишуда илова карда шуд ва сипас барои 20 сония центрифуга карда шуд. Сипас, пас аз хориҷ кардани supernatant, 150 μl хуноба назорати инсон бо пайвастагии озмоишӣ ё бидуни он ба пеллет илова карда шуд. Ҳар як суспензия фавран ба минифидерҳои инфиродӣ бо мембрана пӯшида ва 20 3-5 рӯз ворид карда шуд. Анофелес Стефенси ба магасхо 10—15 дакика гизо дода шуд. Пас аз шаш рузи гизодихй дар хар як хурокдиханда 20 мушунг чудо карда шуд. Шумораи мутлаки ооцистҳо ба воситаи микроскопияи рӯшноӣ пас аз ранг кардани меъдаи магас бо 2% меркурохром ҳисоб карда шуд. Рақамҳои oocystҳо ҳамчун миёнаи арифметикии шумораи ооситҳои 20 хомӯшакҳои ҷудошуда ҳисоб карда шуданд ва фаъолияти коҳишдиҳандаи интиқоли пайвастагиҳои санҷидашударо ифода мекунанд. Дар дар зинда Арзёбии фаъолияти басташавии интиқол бо паразитҳои хояндаҳо ба таври зерин анҷом дода шуд. Ин тадқиқот мувофиқи қоидаҳои ҳифзи ҳайвоноти ИМА тибқи протоколе, ки аз ҷониби Донишгоҳи Калифорния дар Кумитаи нигоҳубин ва истифодабарии ҳайвонот дар Сан Диего тасдиқ шудааст, гузаронида шуд. Мушҳо бо 5 × 10 5 сироят ёфтаанд П.бергхеи ANKA 676m1cl1 паразитҳо дар рӯзи 0 тавассути тазриқи дохили перитоналӣ. Сипас ба мушҳо бо 100 мг KAF156/кг (дар 0,5% [ваз/ҳаҷм] метилселлюлоза [Сигма-Алдрих, каталоги № M0262] ва 0,5% [ҳаҷм/ҳаҷм] Tween 80 мураттаб шудааст) ё назорати даҳонӣ дар як рӯз таъин карда шуд. 5 вақте ки паразитемия ба 5 то 6% мерасад. Ғизо баъд аз 24 соат дар рӯзи 6 анҷом ёфт. Ооцистаҳо бо микроскопияи рӯшноӣ пас аз ранг кардани меъдаи магасҳо бо 2% меркурохром ранг карда шуданд.

П. ёелӣ ташхиси зидди табларза дар ҷигар.

Ин санҷиш қаблан тавсиф шуда буд (13). Кутоҳ, П. ёелӣ (17XNL) спорозоитҳо пас аз ҷудо кардани ғадудҳои даҳони сироятшуда ба даст оварда шуданд. А.Стефенси магасҳое, ки аз ҷониби ҳашароти Донишгоҳи Ню-Йорк дода шудаанд. Ғадудҳои гилро ҷудошуда дар суфтакунандаи бофтаи шишагӣ гомогенизатсия карда, ду маротиба тавассути филтрҳои ҳуҷайраҳои нейлонӣ филтр карда шуданд (ҳаҷми сӯрохи BD Falcon 40- & # x003 миллиард см) ва бо истифода аз гемоцитометр ҳисоб карда шуданд. Сипас, 7,5 × 10 3 ҳуҷайраҳои HepG2-A16-CD81 EGFP дар 50 μl миёна (1,5 × 10 5 ҳуҷайра/мл) дар лавҳаҳои 384-чоҳ (Aurora 384 IQ-EB сиёҳ) тухмипошак карда шуданд. ) 20 то 26 соат пеш аз сирояти воқеӣ. Ду соат пеш аз сироят, 50 нл пайвастагӣ дар DMSO (0,1% консентратсияи ниҳоии DMSO дар як чоҳ) бо PinTool (GNF Systems) ба лавҳаҳои санҷишӣ (консентратсияи ниҳоии 10 º03bcM) интиқол дода шуд. Атовакуон, як доруи экзо-эритроситикии шизонтицидии тасдиқшуда (10 º003bcM) ва 0,1% DMSO мутаносибан ҳамчун назорати мусбӣ ва манфӣ истифода шуданд. Пас аз он ҳуҷайраҳои HepG2-A16-CD81 EGFP бо 8 × 10 3 спорозоитҳо дар як чоҳ сироят карда шуданд ва плитаҳо дар 650 × чарх заданд. ж. Пас аз сироят ва 1 соати инкубатсия дар 37ºС, фарҳангҳо шуста шуданд, медиаи нав ва пайвастагиҳо илова карда шуданд ва фарҳангҳо минбаъд бо консентратсияи 5 маротиба зиёдшудаи пенициллин-стрептомицин барои 48 соат дар 37ºС инкубатор карда шуданд. Ҳуҷайраҳои сироятёфта тавассути иммунофлуоресценсия муайян карда шуданд. Барои сироят кардани як чоҳ тақрибан 8,000 спорозоитҳо истифода шуданд ва ҳуҷайраҳои сироятшудаи HepG2-A16-CD81 EGFP дар тӯли 48 соат ба пайвастагиҳо дар консентратсияи 10 ºx003bcM дар DMSO гудохта шуданд. Тақрибан нисфи майдони умумии чоҳ тасвир шудааст, ки ба ҳисоби миёна тақрибан 50 ҳуҷайраи сироятшударо фаро гирифтааст.

Дар vivo таҳлили самаранокии профилактикаи сабабҳои муш.

Ин таҷрибаҳо дар муассисаи USAMC-AFRIMS (аз ҷониби Ассотсиатсияи баҳодиҳӣ ва аккредитатсияи лабораторияи нигоҳубини ҳайвоноти байналмилалӣ аккредитатсия шудааст) дар Бангкок, Таиланд гузаронида шуданд. Хулоса, мушҳо (бар як гурӯҳи таҷрибавӣ панҷ нафар) пайвастагиҳои санҷиширо дар рӯзи 0, 2 соат пеш аз эмкунии паразит гирифтанд. Ҳайвоноти назоратӣ ҳамон миқдор мошинро бидуни дору гирифтанд. Atovaquone, як доруи профилактикии зидди малярия, ҳамчун назорати мусбӣ истифода шудааст. Мо қаблан муайян карда будем, ки атоваквон ҳангоми як вояи даҳони 2,5 мг/кг, дар ин модел комилан муҳофизат мекунад (маълумоти нашрнашуда). Дар рӯзи 0, ҳамаи мушҳои ICR (захираи пештара) бо вояи стандартии 0,1 мл 10 5 сироят ёфтанд. П.бергхеи спорозоитҳо бо роҳи тазриқи дохили варид. Намунаҳои таҳқири хун дар рӯзҳои 4, 5, 6, 7, 10, 15, 21 ва 31 postinoculation гирифта шуданд. Мушҳо дар як рӯз ду маротиба барои нишонаҳои клиникӣ ва фавт мушоҳида карда шуданд. Дар рӯзи 7 ва баъд аз он, ҳайвонот бо паразитемияи зиёда аз 5% эвтаниз карда шуданд. Дар як тадқиқот оид ба вояҳо, KAF156 дар шакли суспензияи 0,5%, (ваз/ҳаҷм) метилселлюлоза ва 1% (ваз/ҳаҷм) Solutol HS15 дар 1, 5, 10 ё 15 мг/кг ба таври шифоҳӣ таъин карда шуд. Фаъолияти профилактики бо рохи тахлили сурохии хун назорат карда шуд ва он аз чихати зинда мондани муш дар давоми 30 руз ифода меёбад.

Дар vivo таҳлили самаранокии табобати муш.

Ҳама дар зинда Тадқиқотҳои самаранокӣ аз ҷониби мақомоти байтории Кантони Базел-Штадт тасдиқ карда шуданд. Дар дар зинда Фаъолияти зидди табларза одатан барои гурӯҳҳои панҷ муши NMRI-и занона (20 то 22 г), ки дар рӯзи 0 бо 2 × 10 7 эритроситҳои бо паразитӣ паразитшуда ба дохили вена сироят шудаанд, арзёбӣ мешуд. П.бергхеи Протеини сабзи флуоресцентӣ (GFP) ифодакунандаи паразитҳо (PbGFPCON, меҳрубонона аз ҷониби A. P. Waters ва C. J. Janse, Glasgow and Leiden Universitys тақдим карда шудааст) (24, 25) (барои пайвастагиҳои истинод ба ҷадвали 1 ва инчунин Ҷадвали S2 дар маводи иловагӣ нигаред) ё П.бергхеи Штамми истинод ба ANKA (барои ҳама таҳқиқоти дигар). Аз маълумоти таърихӣ, мушҳои назоратнашаванда маъмулан дар байни рӯзҳои 6 ва 7 пас аз сироят мурданд, аммо дар ин таҳқиқот ҳама ҳайвоноте, ки аломатҳои паразитемия ё вараҷаро нишон медиҳанд, дар рӯзи 4 бо CO2 ба таври инсонӣ эвтаниз карда шуданд.2. Пайвастагиҳои таҷрибавӣ дар 7% (ҳаҷм/ҳаҷм) Tween 80≥020133% (ҳаҷм/ҳаҷм) этанол, 10% этанол (ҳаҷм/ҳаҷм), 30% (ваз/ҳаҷм) PEG400, 60% (ваз/ҳаҷм) Vit тартиб дода шудаанд. E TPGS (Eastman) ё 5% (ваз/ҳаҷм) Solutol HS15 (BASF) тавре нишон дода шудааст. Пайвастшавӣ ба таври даҳонӣ дар ҳаҷми 10 мл/кг ҳамчун як вояи якдафъаина (24 соат пас аз сироят), се вояи пайдарпайи ҳаррӯза (24, 48 ва 72 соат пас аз сироят) ё чаҳор вояи пай дар пай (6, 24, 48, ва 72 соат пас аз сироят). Бо режими яккарата мо паразитемияро дар 72 соат пас аз инфексия муайян кардем ва барои режими сегона ва чоркунҷа паразитемияро дар 96 соат пас аз инфексия бо усулҳои стандартии ситометрияи ҷараён ё микроскопияи стандартӣ муайян кардем [25]. Фаъолият ҳамчун фарқи байни фоизи миёнаи паразитемия барои назорат ва гурӯҳҳои табобатшуда ҳамчун фоизи гурӯҳи назоратӣ ҳисоб карда шудааст. Давраи зиндамонӣ бо рӯзҳо низ то 30 рӯз пас аз сироят сабт шудааст. Агар ҳайвон то рӯзи 30 пас аз сироят бидуни паразитҳои ошкоршаванда зинда монад, пайвастагӣ табобатшаванда ҳисобида мешуд.

ЉАДВАЛИ 1

Дар vivo самаранокии KAF156 дар a П.бергхеи модели вараҷаи хояндаҳо а

Микдори вояи (мг/кг)Мушкилот бМаънои & # x000b1 SD Табобат (%) г
Фаъолият (%)Зиндагии муш (рӯзҳо) в
1 × 30хлорохин*99,9 & # x000b1 0,079.6 ± 0.80
Мефлокин*99,6 & # x000b1 0,521.8 ± 2.10
Артесунат*92.4 ± 2.99,0 ± 1,20
KAF156 †99,9 & # x000b1 0,00616,7 ± 2,80
1 ва#x000d7 100Хлорохин*99.912.70
Artesunate*99,9 & # x000b1 0,088,8 ± 0,80
KAF156 & # x0202099,9 & # x000b1 0,00823,4 ± 4,310
3 × 30Хлорохин‡99,9 & # x000b1 0,0214,0 & # x000b1 0,00
Мефлокин‡98,6 & # x000b1 0,318.8 ± 1.30
Artesunate & # x0202199,0 & # x000b1 0,311,8 ± 3,30
3 × 50KAF156 & # x02020& # x0003e99,9929,4 ± 0,840
4 × 100KAF156 †& # x0003e99,9929.8 ± 0.690

In vitro интихоби муқовимат.

Аҳолии клоналии аҳолӣ P. falciparum Штамми Dd2 барои оғоз кардани се фарҳанги мустақили паразитӣ дар зери фишори ибтидоии интихоби 1,8 нМ KAF156 (колба/штамм 1, 2 ва 3) истифода шудааст. Паразитемия ҳар рӯз назорат карда мешуд ва консентратсияи таркиб 2 маротиба зиёд шуд, вақте ки паразитемия ба 𢙓% расид. Пас аз 1 моҳи интихоб, ҳар як фарҳанг ба ду фарҳанг тақсим карда шуд (фарҳанги 1, 1A ва 1B фарҳанги 2, 2A ва 2B ва фарҳанги 3, 3A ва 3B) бо мақсади суръат бахшидан ба рушди муқовимат дар ҳар як ҷуфт тавассути баланд бардоштани консентратсияи &# x0003e2-fold (𠇋 ”) дар ниҳоят шаш зотҳои тобоварро пас аз 4 моҳи фарҳанги пайваста дар афзоиши консентратсияи KAF156 тавлид мекунанд. Барои ҳар як шаш штамми тобовар, полиморфизмҳои як нуклеотидҳо (SNPs) тавассути пайдарпаии тамоми геном (технологияи Illumina) ё пайдарпаии капиллярӣ (ба поён нигаред) муайян карда шуданд.

Ҳассосияти ҳар як штамми тобовар ба KAF156, GNF707 ва GNF452 (сохторҳои кимиёвӣ ва синтези GNF707 ва GNF452 дар ҷои дигар [13] тавсиф шудаанд) муайян карда шуд ва тағирёбии қабати самаранокӣ (яъне тағирёбии ҳассосияти фенотипӣ ҳисоб карда шуд).

Барои муайян кардани басомади муқовимат, хатҳои клоншудаи Dd2 (1pa) ва FCR3 дар муҳити пурраи RPMI 1640 (0,5% Albumax) дар ҳаҷмҳои гуногун (2 то 320 мл) парвариш карда шуданд. Паразитҳо бо IC фишор оварда шуданд50 дар интихоби яккарата ва дар давоми 60 рӯз ё то пайдо шудани паразитҳои муқовимати зери интихоб парвариш карда мешавад. Пеш аз интихоб, фарҳангҳои ибтидоии паразитҳо то ≥1,5 литр дар колбаҳои сершумор васеъ карда шуданд, ҷамъ карда шуданд ва мувофиқи эмкунии ибтидоии мувофиқ тақсим карда шуданд. Маданиятҳои марҳилаи ҳалқавӣ асосан ба маводи мухаддир дучор мешуданд ва фарҳангҳо ҳар рӯз барои 6 рӯз ва баъд аз ҳар рӯзи дигар то пайдоиши паразитҳо ғизо дода мешуданд.

Таҳлили геноми мутантҳои ба маводи мухаддир тобовар.

Тарҳрезии праймерҳои PCR барои тақвият додани як ген, ки мо номбар кардем P. falciparum Муқовимати минаҳоpfcarl PlasmoDB ID PFC0970w) барои пайдарпайии Сангер аз сабаби фоизи баланди нуклеотидҳои A+T дар ин ген мушкил буд. Аз ин рӯ, мо праймерҳои дарози PCR-ро дар атрофи ген тарҳрезӣ кардем, ки аз минтақаҳои баланди A+T канорагирӣ кунем, то ду порчаи такроршавандаро, ки дар маҷмӯъ 𢏅,9 кб фарогиранд (пайдарпайвандҳои праймер дар зер) васеъ кунанд. Sequencing libraries were made from these fragments using Nextera library preparation kits (Illumina, San Diego, CA). Paired 60-bp reads were generated on an Illumina GAIIx instrument. Reads were aligned to the P. falciparum strain Dd2 using SOAP (26). Nucleotide changes from the reference sequence were called where at least six separate reads called the alternate letter, and the sum of the Illumina quality scores of the alternate letter from all reads containing that letter were 5× the sum of the Illumina quality score of the reference letter in all of the reads that contained that letter. A new reference sequence was generated with these SNP changes, and the reads were aligned with SOAP against the improved genomic sequence new SNPs were discovered, and this process was iterated nine times. The long PCR primer sequences were as follows: pfc970w_long1F, TTTGTCTTTTCTAGTTATAATGATTT pfc970w_long1R, GATCTGTAGTAATAACTGATTGTGGTGAAT pfc970w_long2F, TTTTGTCTTTTCTAGTTATAATGATTTTTTAAAAAACTAAAAGAAGCAC and pfc970w_long2R, GTCAAAAGATCTGTAGTAATAACTGATTGTGGTGAAT.


Реферат

In recent years, there has been a growing interest in researching and developing new antimicrobial agents from various sources to combat microbial resistance. Therefore, a greater attention has been paid to antimicrobial activity screening and evaluating methods. Several bioassays such as disk-diffusion, well diffusion and broth or agar dilution are well known and commonly used, but others such as flow cytofluorometric and bioluminescent methods are not widely used because they require specified equipment and further evaluation for reproducibility and standardization, even if they can provide rapid results of the antimicrobial agent's effects and a better understanding of their impact on the viability and cell damage inflicted to the tested microorganism. In this review article, an exhaustive list of in vitro antimicrobial susceptibility testing methods and detailed information on their advantages and limitations are reported.


The next epidemic

In about 50 years, more than a quarter of the world will be over 65 years of age. It's even worse for some countries: the projections are that at that time, Japan and Germany could have 50% of their population in that category. The figure for the US is estimated to be about one-third. The fastest growing demographic segment in most developed nations is people 85 and older. We are witnessing something utterly unprecedented in human history: an explosion of people well past their reproductive years.

Evolution ceases to care about an organism when it has done its job of passing its genes to the next generation. As far as we know, natural selection does not increase the fitness of an individual for later life indeed, there is some reason to think that longevity may be harmful in an evolutionary sense. Older, non-reproducing organisms consume resources that might better serve their younger, breeding brethren. And chief among these resources is medical care, because old age is a risk factor for just about everything bad that can happen physically.

Cancer (most types, anyway) and heart disease are just two of the conditions that afflict the elderly much more frequently than the young. Osteoporosis, pneumonia and other potentially fatal infectious diseases are amongst the others and the list is a long one. But in almost no case is the deleterious effect of aging more dramatic than in the case of neurologic diseases. With the exception of a few rarer ones such as amyotropic lateral sclerosis (Lou Gehrig's disease) and Huntington's disease, which do their damage earlier, the incidences of Alzheimer's disease and other dementias and of Parkinson's disease and other movement disorders increase exponentially starting at about age 60, such that by the time a person reaches their mid-80s, their chance of showing symptoms of at least one of these conditions approaches 50%. The prevalence of Alzheimer's alone doubles every 5 years past age 60. Right now, in the US, there are about 1 million people with Parkinson's disease and about 5 million with Alzheimer's disease (the corresponding figures for the UK are just under a million Alzheimer's cases and about 200,000 Parkinson's cases). Exact figures are impossible to get because there is overlap in symptoms between cognitive and movement disorders in many patients and definitive diagnosis is often not possible until autopsy. But what is clear is that the major neurologic diseases cost the US about a third of a trillion dollars a year, out of a gross domestic product of $12.7 trillion. If you think that's a lot, and it is, then brace yourself: in fifty years, unless something is done, all of these figures will at least triple. There will be 15 million US Alzheimer's patients, 3 million with Parkinson's disease, and the annual cost will be over 1 trillion dollars. Every other western nation will experience similar increases. No economy can survive that.

One reason the future looks so bleak is that there is at present not a single effective treatment for any of the major neurologic disorders. Promising ones are claimed to be in the pipeline for the big killers like stroke and Alzheimer's, but then, we've been hearing those promises for at least three decades. And the 'lesser' scourges such as Parkinson's disease and other movement disorders are considered to have prevalence too low for most major pharmaceutical companies to be interested in developing therapeutics for them. So bloated, and debt-laden, have some drug companies become after the recent round of mergers that a disease offering only a million patients is considered unlikely to generate the return on investment needed.

This would appear to leave a clear field for biotechnology companies, but they haven't exactly been leaping into the breach either. Many appear to be scared off by the difficulty in doing clinical trials for diseases like Parkinson's (to be fair, big drug companies are worried about the same thing). Neurodegenerative diseases are typically slowly progressing with variable rates of decline and complex symptomology. Picking a suitable clinical end-point is hard enough, but when you add to it the likely time required for a trial for a disease like Parkinson's, which typically has a 20-year progression, it's understandable that even the major pharmaceutical companies are wary.

Governments often need to step in when the private sector is reluctant, and to some extent they have, but much of the innovative research in neurodegenerative diseases is funded, at least initially, by private foundations set up by patient advocacy and support groups. Thanks to them, there has been progress, but things are still moving very slowly.

Ironically, neurologic diseases may be a lot easier to treat than disorders like cancer. If you want to cure cancer, you had better be perfect, because if you let even one rogue cell escape, that may, in theory at least, be enough to start a fatal metastasis. I don't know about you, but I'm far from perfect - just ask my research group. But if you want to 'cure' Alzheimer's or Parkinson's disease, which are typically late onset and slowly progressing, you don't have to be perfect. Delay the average age of onset by a decade or two and the problem becomes much less serious. Slow the rate of progression by just one order of magnitude and a fatal disease may no longer be a significant problem for most people. In other words, for neurodegenerative disorders, all that may be required is to buy enough time.

Increasing evidence suggests that genomics should be a significant contributor to doing just that. Because the most common forms of the major neurologic diseases are sporadic and idiopathic, it was long thought that genetic factors played a relatively minor role in susceptibility (compared with, say, environmental factors and diet). But recent twin studies in Scandinavia and elsewhere paint a very different picture. Monozygotic twins show a high correlation in incidence of Alzheimer's disease compared with nonidentical twins, where the correlation is low. The best current guess is that more than 75% of the susceptibility to sporadic Alzheimer's disease may be due to genetic factors. The figure for Parkinson's disease is estimated to be lower, below 50%, but still substantial. Since most neurologic disorders don't present with symptoms until a sizeable fraction of the relevant neurons have already died off, many neurologists have felt that preventative measures were a better long-term strategy than trying to arrest the progress of the disease. The problems are: how do you measure efficacy of prevention for a sporadic disease, and how do you avoid having to give the preventative drug to the entire elderly population? The recent sad story of Vioxx, an arthritis painkiller that had to be withdrawn from the market after it was linked to increased incidences of heart attacks and strokes, shows what can happen when a drug is administered to a larger population than absolutely need it.

But if the tools of genomics allow us to identify genetic risk factors for the sporadic disease, then preventative measures can focus on reducing the risks for that population only, down to 'normal' levels, which in fact may be very small. The recent discovery that Ashkenazi Jews who are carriers for Gaucher disease are at increased risk of developing Parkinson's disease represents, I think, just the beginning of what should be a massive effort to identify the haplotypes that predispose individuals to a high risk of neurodegenerative disease.

Meanwhile, the incipient epidemic still needs to be checked. The best hope short-term probably lies with drugs that slow or arrest the neuronal decay. Finding them requires that the clinical trials problem be solved, but I don't think that may be as daunting as it seems. All of the major neurologic diseases have rarer, closely related conditions that are much more rapid in their progression and that have death as a clinical end-point. For example, although Parkinson's disease progresses very slowly, multiple system atrophy, which has similar pathology and appears to involve many if not most of the same molecular players, is usually fatal within about five years of diagnosis. Using these faster diseases as surrogates for the slower may be a way to design clinical trials with a clear outcome (survival) and an acceptable duration. But that requires accurate and early diagnosis of these conditions, which currently is very difficult to do, as they all resemble one another in many of their symptoms. Microarray analysis of gene expression and other genomics tools may help overcome this problem, which right now represents the major obstacle to progress.

The hope then is that genomics will make it feasible for biotechnology companies and large pharmaceutical firms to expand the scope of their efforts in neurologic diseases. If they don't, we could be looking at a future in which the human life span is continually extended but the quality of that later life is horrible. I don't know about the H5N1 virus and the avian flu as I've written previously in my column (Genome Biology 2005, 6:121), the prospects for that epidemic are uncertain. But the coming neurologic crisis is an epidemic that is as sure as anything I know of. And this one won't be confined to a third world country, or to some place safely remote. The clock is ticking for all of us.


Видеоро тамошо кунед: Một số điểm cần lưu ý về thuốc sinh học và thuốc sinh học tương tự. Nguyễn Hoàng Anh (Сентябр 2022).


Шарҳҳо:

  1. Bern

    Not a bad site, I found a lot of interesting information

  2. Burney

    Ба назари ман, ин равшан аст. Кӯшиш кунед, ки ҷавоби саволи худро дар google.com ҷустуҷӯ кунед

  3. Kirklyn

    Чизи аҷиб, ман назар афкандам, ман ба ҳама маслиҳат медиҳам ...

  4. Kelabar

    ман бояд

  5. Shakara

    Quickly answered :)

  6. Telford

    It is the answer of value



Паём нависед