Маълумот

A10. Пайвандҳо ва истинодҳои умумӣ - Биология

A10. Пайвандҳо ва истинодҳои умумӣ - Биология


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

A10. Истинодҳо ва истинодҳои умумӣ

Ба химияи умумӣ оғоз кунед

Эзоҳ: истинодҳо дар нусхаҳои бойгонии саҳифаҳое мебошанд, ки аз байн рафтаанд ва дигар нигоҳ дошта намешаванд.

Китобҳои дарсии химия ройгон зеркашӣ карда мешаванд

Сарсухан аз фанни химия аз ҷониби Марк Бишоп. Ду версияи ин китоби дарсии ҷорӣ мавҷуд аст, ки ҳарду дорои як маълумот мебошанд, вале ба таври гуногун ташкил карда шудаанд: версияи "Chemistry-birst", аз "химия" оғоз мешавад — яъне муодилаҳо ва реаксияҳои кимиёвӣ. Формати алтернативии "Atoms-first" ин маводро барои баъд нигоҳ медорад ва аз назарияи атомӣ ва пайвастшавӣ оғоз мешавад. Барои зеркашии версияҳои PDF, Chemistry-First ё Atoms-First-ро интихоб кунед. Лутфан таваҷҷӯҳ намоед, ки гарчанде ки шумо метавонед инҳоро ройгон зеркашӣ кунед, Марк хоҳиш мекунад, ки аз онҳое, ки аз онҳо мунтазам истифода мебаранд, маблағи 20 доллари амрикоӣ пардохт мекунанд. Бобҳои инфиродӣ барои iPad, iPhone, дастгоҳҳои Android ва Kindle низ дастрасанд: Chemistry-First, Atoms-First.

Принсипҳои химиявӣ, Нашри 3-юм (Ричард Дикерсон, Гарри Грей ва Гилберт Ҳейт, 1979) - Ин матни соли 1979 барои аксари курсҳои соли аввали химияи умумӣ хуб арзёбӣ мешавад. Ҳар як бобро метавон ҳамчун файли алоҳидаи pdf зеркашӣ кард, то бубинад, ки кадоме ба шумо лозим аст, мушро болои тасвир ҳаракат кунед ва сарлавҳа пайдо мешавад.

Принсипҳои химиявӣ (Бунёди CK-12 Шарон Бевик, Ҷоҳатан Эдҷ, Терезе Форсит, Ричард Парсонс) Як файли ягонаи 900-саҳифа, 51 Мб pdf зеркашӣ.

Химияи умумӣ - китоби дарсии ройгон, ки аз асари муаллифони гуногун тартиб дода шудааст. Он дар формати файли "help" дастрас аст, ки бо MS Windows кор мекунад. Лутфан тафсилотро дар ин ҷо бубинед.

Принсипхои химияи умумй - ҳамчун файли PDF (147 Мб) ё ҳамчун файли zip барои истифодаи офлайн бо браузери веб дастрас аст.

Термодинамика ва химия - аз ҷониби Ҳовард ДеВо, У. Мэриленд (2014) Ин китоби ройгон дар формати PDF нусхаи бознигарӣ ва васеъшудаи нашри аввал аст, ки соли 2001 аз ҷониби Прентис Холл дар формати муқоваи сахт нашр шудааст.

Китоби ройгони химияи органикӣ - Бобҳои алоҳидаи Химияи органики аз ҷониби Дейли ва Дэйли метавонад ҳамчун файлҳои pdf зеркашӣ карда шавад.

Лексияҳои онлайн дар сатҳи коллеҷ

UC-Berkeley eChem1a: Химияи умумӣ онлайн - Ин видеоҳои аз ҷиҳати касбӣ сохташуда, ки аксари онҳо профессор Марк Кубинецро дар бар мегиранд, сифати аъло доранд - шояд беҳтарин дарсҳои химияи умумӣ дар сатҳи коллеҷ дастрас бошанд. дастурҳои ҳалли мушкилот, викторинаҳои интерактивӣ ва намоишҳои лабораторӣ. Аксари видеоҳо хеле кӯтоҳанд (5-15 дақиқа) ва онҳоро бо ҳама гуна тартиб дастрас кардан мумкин аст.

Принсипҳои MIT дар илми химия — Ин MIT OpenCourseWare курс муқаддима ба химияи молекулаҳои биологӣ, ғайриорганикӣ ва органикӣ мебошад. Таваҷҷуҳи асосӣ ба принсипҳои асосии сохтори электронии атомӣ ва молекулавӣ, термодинамика, мувозинати кислотаю асос ва редокс, кинетикаи химиявӣ ва катализ дода мешавад. Бештар лексияҳо ва видеоҳои химияи MIT.

Йел Freshman химияи органикӣ - Боз як силсилаи олиҷаноб, ин як курси ду семестри соли аввалро дар бар мегирад, ки химияи органикиро дар бар мегирад. Инҳо лексияҳои зинда дар синфхона мебошанд, ки аз ҷониби профессор Ҷ. Майкл Макбрайд дода шудааст. Тавсифи ӯ дар бораи рушди таърихии мафҳумҳои муҳим ғайриоддӣ хуб буда, ба фаҳмиши онҳо изофа мекунад. Баъзе слайдҳои пешбинишударо хондан душвор аст.
Лексияҳои нимсолаи якум - Лексияҳои семестри дуюм

Reacciones Químicas y Cálculos Estequiométricos - Aprenderás los Conceptos Básicos de las Reacciones químicas ва profundizezarás ва su studio cuantitativo (estequiometría). (Universitat Politècnica de Valencia)

Захираҳои интернетӣ барои химияи умумӣ

ChemWiki: Китоби электронии химияи динамикӣ - муносибати муштарак ба таълими химия, ки дар он муҳити китобҳои дарсии Дастрасии кушод пайваста аз ҷониби донишҷӯён ва омӯзгорон навишта ва аз нав навишта мешавад, ки дар натиҷа як китоби ройгони химия барои иваз кардани китобҳои муқаррарии коғазӣ оварда мешавад. Мавод ба бахшҳои химияи аналитикӣ, биологӣ, ғайриорганикӣ, органикӣ, физикӣ ва назариявӣ тақсим карда шудааст. Ҳар яке аз инҳо мавзӯъҳоеро дар бар мегиранд, ки одатан ба химияи "умумӣ" дохил мешаванд ва инчунин мавзӯъҳои пешрафтае, ки аз сатҳи коллеҷи соли аввал фаротаранд.

Химияи умумӣ онлайн! - дастури интерактивӣ ва манбаи веб барои донишҷӯён ва муаллимони муқаддимавии химияи коллеҷ, ки аз ҷониби Фред Сенезе аз Донишгоҳи давлатии Фростберг (MD) нигоҳ дошта мешавад. Сарвати хуби мавод, аз ҷумла маҷмӯаҳои ёддоштҳо ва дастурҳо барои муқаддимавии химияи умумӣ, варақаҳои санҷиши малакаҳо ва имтиҳонҳои худбаҳодиҳии онлайн ва сутуни саволу ҷавоб.

Сарсухан аз фанни химия - нусхаи онлайни матн аз ҷониби Марк Бишоп аз Коллеҷи Монтерей (CA). Он асосан барои донишҷӯёни курсҳои ибтидоии химия пешбинӣ шудааст. ($20 "donate-ware", ва ба маблағи он!)

Химияи виртуалӣ - ин сайти зебо аз ҷониби Чарлз Офардт аз Коллеҷи Элмхурст доираи васеи химияи умумӣ, органикӣ ва экологиро фаро мегирад. Маводи матнӣ ҷолиб ва хуб навишта шудааст, бидуни кӯшиши энсиклопедӣ.

Китоби дарсии виртуалии химияи умумӣ - маҷмӯаи ройгони муолиҷаҳои ҳамаҷонибаи амиқи мавзӯъҳои гуногун, ки барои пурра кардан ё иваз кардани муолиҷаҳои анъанавии китобҳои дарсӣ пешбинӣ шудаанд. Он асосан ба сатҳи коллеҷҳои соли аввал нигаронида шудааст, аммо донишҷӯёни синфҳои болоӣ қисми зиёди онро муфид хоҳанд ёфт. (Стив Лоуэр, Донишгоҳи Саймон Фрейзер)

Вебсайти Chemogenesis - ин сайти васеъ, олӣ ва ҳамаҷонибаи Марк Лич нақл мекунад, ки чӣ гуна химия аз Ҷадвали даврӣ пайдо мешавад ва ба илми бой ва ғайриоддӣ, ки мо медонем ва аз сар мегузаронем, тақсим мешавад.

Силсилаи дарси химия дар YouTube ва дигар маҷмӯаҳои видео - мухтасари маҷмӯаҳои асосӣ, аз ҷумла Академияи Хон, ва онҳое, ки аз ҷониби муаллимони гуногун, асосан дар сатҳи мактаби миёна анҷом дода мешаванд.

Викикитобҳо оид ба химия — Дар ин чо бисьёр мавзуъхои химияи умумй фаро гирифта шудаанд ва шоёни тахеин аст. Аммо чун дар ҳама гуна лоиҳаҳои навъи "wiki-", ки ҳар кас метавонад дар он саҳм гузорад, сифат тағйирёбанда ва тарҳи визуалӣ ибтидоӣ аст.

Химияи умумии Таннер - маҷмӯаи зиёди саҳифаҳо оид ба материя (аз ҷумла назарияи квантӣ), химияи физикӣ, электрохимия ва маҳлулҳои обӣ.

AUS-e-TUTE -як сайти таълимии "илмии австралиягӣ, ки аз ҷониби муаллимони ботаҷриба таҳия карда мешавад." Онҳо ба аъзоёни ба қайд гирифташуда дастурҳо, матнҳо, бозиҳо, машқҳо ва инчунин маҷмӯи васеи дарсҳоро барои ғайриаъзоён пешниҳод мекунанд.

Захираҳои веби химия - ин сайте, ки аз ҷониби Рон Райнхарт аз Коллеҷи нимҷазираи Монтерей нигоҳ дошта мешавад, дорои маводи фаровонест, ки ба таълими кимиё нигаронида шудаанд, ки ҳамаашон ба таври визуалӣ ҷолиб ташкил карда шудаанд.

ChemPaths: Захираҳои донишҷӯён барои химияи умумӣ - маҷмӯи ҳамаҷонибаи дарсӣ аз Китобхонаи рақамии таълими химиявӣ

Дониш дари - маҷмӯаи аълои маълумоти марбут ба химия ва илм, ки аз бисёр ҷиҳатҳо нисбат ба Дастур оид ба химия ва физика, ва албатта барои истифода қулайтар. Бояд аз ҷониби ҳар як донишҷӯи ҷиддии химия қайд карда шавад!

Дар Саҳифаи донишҷӯёни ChemCollective ба проблемахои амалия ва дастурхои дарси оид ба мавзуъхои гуногун алока дорад.

Физикаи коллеҷ барои донишҷӯёни биология ва химия - Ин гипердарсии Кен Кёлер хуб ташкил карда шудааст ва ҷои беҳтаринест барои рафтан, вақте ки китоби дарсии химияи шумо шуморо рӯҳафтода мекунад.

Чӣ тавр аз химия гузаштан мумкин аст - маслиҳати солим, ки ба таври васеъ нодида гирифта мешавад.

> - ин маҷмӯаи васеи истинодҳо дар сайти Wilton HS-и Боб Ҷейкоб дар аввали соли 2008 нопадид шуд, аммо ин истинод ба версияи бойгонии соли 2007 бояд ҳам барои химияи умумӣ дар мактаби миёна ва дар сатҳи коллеҷ муфид бошад.

Ин ҳафта дар таърихи химия - қисми сайти аълои химияи классикии Кармен Гиунта (Коллеҷи Ле Мойн) "Ин ҳафта" пешниҳодҳои мини-таймҳоро дар бар мегирад, ки давраи дуҳафтаинаи кунуниро фаро мегиранд.

"Мушкилоти ҳикоят" - чанд маслиҳати амалӣ барои онҳое, ки ба "plug-and-chug" нашъаманданд.

Проблемаҳои химия - мисолҳои коршуда - Ин сайти About.com интихоби одилона дорад.

Ҳашт маслиҳат барои муваффақият дар курсҳои илмӣ - маслиҳати қавӣ аз Донишгоҳи Ҷорҷтаун проф.

Бастаҳои химия аз ҷониби муаллими собиқадор Марк Розенгартен. Маҷмӯаи ёддоштҳо ва варақаҳои корӣ дар формати pdf дар ду маҷмӯи 13 адад, яке барои дипломҳо ва дигаре барои Regents Chemistry. Ҳар як воҳид бо маҷмӯаи хуб ташкилшудаи таърифҳо ва қайдҳо оғоз меёбад ва бо варақаҳои корӣ, ки метавонанд ҳамчун вазифаи хонагии донишҷӯ хизмат кунанд, идома меёбад. Гарчанде ки дар мактаби миёна равона карда шудаанд, ин маводҳо метавонанд ҳамчун баррасии хуб барои донишҷӯёни химияи коллеҷ хидмат кунанд.

Мавзӯҳои химияи умумии Донишгоҳи Пурдю - Қайдҳо ва проблемаҳо оид ба шумораи зиёди мавзӯъҳо.

ChemSpider "аст як пойгоҳи ройгони сохтори кимиёвӣ, ки дастрасии фаврии ҷустуҷӯи матн ва сохторро ба зиёда аз 58 миллион сохторҳо аз садҳо манбаи маълумот фароҳам меорад."

Видеоҳо барои химияи умумӣ

Ҳоло эҳтимолан ҳазорҳо инҳо дар YouTube ва дигар сайтҳо мавҷуданд - хеле зиёданд, ки як шахс аз назар гузаронад, бигзор аз навсозӣ нигоҳ дошта шавад. Дар соли 2013, ман рӯйхати баъзе аз видеоҳои беҳтареро тартиб додам, ки онҳоро сазовори тавсия ба дигарон донистам.

Клиникаи химиявии доктор Браун- сайти барраси/таҷдиди умумӣ барои GCSE UK, AS ва A2 химия ва ИМА/Канада синфҳои 9-12. Қайдҳои такрорӣ, санҷишҳои сершумор, саволҳои сохторӣ, графика ва истинодҳои васеъ ба сайтҳои муфид ва ҷолиби ХИМИЯ. Як хусусияти сайт сохтор ва номгузории пайвастагиҳои органикӣ мебошад.

Мураббии химия саҳифаи дастгирии курсҳои мактаби миёна бо таносуби энкликлопедӣ мебошад. Муаллиф аз ҷониби Боб Ҷейкобс Мактаби миёнаи Вилтон, ин сайти хуб ташкилшуда дорои садҳо истинодҳое мебошад, ки барои донишҷӯён ҳам дар сатҳи мактаби миёна ва ҳам дар соли аввали коллеҷ шавқовар хоҳанд буд.

ChemThink - Ин сайти нав аз як қатор дарсҳои интерактивӣ дар асоси викторина иборат аст. Инчунин якчанд симуляторҳои лабораторӣ мавҷуданд. Бақайдгирӣ талаб карда мешавад, аммо ройгон аст.

ChemTutor мавзӯъҳои гуногунро фаро мегирад - асосан ба HS ва AP Chemistry нигаронида шудааст.

Дар Дастаи химия - Дарсҳо барои химияи мактаби миёна дар ҳама мавзӯъҳои стандартӣ барои донишҷӯёни мактаби миёна ва химияи такмили ихтисос.

Химияи умумӣ И, Химияи умумӣ II - "Китоби дарсии виртуалӣ" ва маҷмӯи боэътимоди ёддоштҳои лексияҳо, ки курси пурраи коллеҷро дар бар мегиранд, аз ҷониби Майкл Блэбер аз иёлати Флорида U. Ба чаҳорчӯбаи чап нигаред, то бубинед, ки кадом мавзӯъҳо мавҷуданд.

Мерлин Принсипҳои алхимия а аст китоби гипердарсии химия дар шакли маҷмӯи зиёди файлҳои HTML, ки корбарон зеркашӣ мекунанд ва сипас тавассути веб-браузерҳои худ офлайн мебинанд. Он ба таври ҷолиб ташкил карда шудааст ва барои дастгирии корбароне пешбинӣ шудааст, ки дорои доираи васеи маълумот ва қобилиятҳо, аз ҷумла хонандагони хонагӣ ва хонандагони калонсол мебошанд. Барои зеркашии мавод ҳаққи номиналӣ вуҷуд дорад.

Назарияи квантӣ ва атом - маҷмӯи хуб ташкилшуда ва фаҳмо аз веб-саҳифаҳое, ки механикаи квантӣ ва барномаҳои онро дар бар мегиранд, аз ҷумла чунин саҳифаҳои амалӣ, ба монанди сканҳои гурбаҳо ва печҳои печи печи. Ба маблағи як назар!

Сомонаи HyperMedia Virginia Tech дорои якчанд саҳифаҳои хуби дарси химияи умумӣ мебошад.

Таҷрибаҳои виртуалии химия - маҷмӯаи дастурҳои интерактивии химия дар асоси веб. Дар дарсҳо Physlets ва Chemistry Applets истифода мебаранд, то таҷрибаҳоро тақлид кунанд ё сохтори молекулавӣ ва атомиро тасвир кунанд. Мавзӯъҳо мувозинат, кинетика, химияи координатсия ва сохтори кристаллро дар бар мегиранд. (Дэвид Блауч, Коллеҷи Дэвидсон)

Асосҳо

Химия ҳама чиз дар бораи чӣ аст? Муқаддима ба илми химия. Ин дастур кӯшиш мекунад, ки мафҳумҳои асосиеро, ки химияи муосирро муайян мекунанд, бидуни, албатта, ба тафсилоти шадид пешниҳод кунанд! Маҷмӯа бо шарҳи мусаввар дар бораи ҷараёнҳои асосии химияи муосир ба охир мерасад. (С. Поён, Саймон Фрейзер У.)

Пешниҳодҳо: чизҳое, ки шумо бояд пеш аз омӯхтани химия хеле дур донед - дастурҳои дарсӣ, ки мавзӯъҳои зеринро дар бар мегиранд: тасниф ва хосиятҳои модда, зичӣ ва оббозӣ, энергия, гармӣ ва ҳарорат, воҳидҳо ва андозаҳо, хатогии андозагирӣ, рақамҳои муҳим ва яклухткунӣ (ин се мавзӯи охирин бо се мавзӯи аввал дар дарси тавсифшуда якхелаанд. дарҳол дар зер.) (С. Поён, Саймон Фрейзер У.)

Материя ва андоза: ҳама дар бораи воҳидҳо, номуайянӣ, рақамҳои назаррас,ва чӣ тавр бо хатогиҳои таҷрибавӣ мубориза бурдан мумкин аст. Фарогирии ҳамаҷонибаи ғояҳои асосии марбут ба воҳидҳо ва андозаҳо, системаи СИ, дақиқӣ, дақиқӣ ва номуайянӣ дар ченакҳо, рақамҳои назаррас ва яклухткунӣ, коркарди хатогиҳои тасодуфӣ ва систематикӣ, инҳирофоти стандартӣ. (С. Поён, Саймон Фрейзер У.)

Воҳидҳо ва омилҳои табдилдиҳӣ - нигаред ба поён

Мувозинат кардани муодилаҳои химиявӣ - 1270 аксуламалҳо, ки ба осон, миёна ва "чалли" ташкил карда шудаанд.

Кислотаҳо ва асосҳо

Ҳама дар бораи кислотаҳо ва асосҳо - ин маҷмӯи ҳафт дарс ҳама чизро дар бар мегирад, ки шумо дар бораи мафҳумҳои бунёдии (Arrhenius, Brønted-Lowry ва Люис) кислотаҳо ва асосҳо донед. Дарсҳои дигар муолиҷаи элементарии рН ва титратсия, тарзи шинохтани моддаҳои туршӣ ва асосиро аз сохторҳои онҳо, инчунин галереяи кислотаҳо ва асосҳои маъмулро дар бар мегиранд. Ба ғайр аз мавод дар бораи рН, дар ин дарс математика вуҷуд надорад, ки ҳисобҳои мувозинати кислота ва асоси дар ин ҷо фаро гирифта нашудаанд.

Кислота-асоси бе алгебра Усули оддии графикии ҳалли мушкилоти рН, ки ба мисли ҳалли алгебравӣ ҷавобҳои хуб медиҳад ва назари глобалии кадом намудҳоро дар ҳама гуна рН муҳим аст. Махсусан барои системаҳои полипротикӣ муфид аст, ки дар акси ҳол ҳалли бисёр муодилаҳои ҳамзамонро талаб мекунанд.

Дарсӣ оид ба кислотаҳо (Формати PDF Dan Dill, Boston U) - ин дастури аъло ҳама мавзӯъҳои асосиро, ки одатан дар сатҳи химияи умумӣ дучор мешаванд, бо коркарди ғайриоддии системаҳои буферӣ фаро мегирад.

Дарсӣ оид ба ҳисобкунии рН ChemBuddy - маҷмӯи васеи дарсҳои онлайн, ки аксари ҷанбаҳои ҳисобҳои кислотаи асосиро дар бар мегиранд. Ҷамъоварии хуби titration- ва қитъаҳои дигар.

Омӯзиши кислотаҳо ва асосҳо (Иттиҳоди Колумбия) - Маҷмӯи дигари дарсҳои хуб ташкилшуда, ки ҳар кадоми онҳо аз як дарси хуб таҳияшуда ва инчунин викторинаҳои сершумор иборатанд.

Фурӯпошии протон: Оё ин кислота бо он асос реаксия мекунад? Чӣ тавр фаҳмидан кислотаи асосй реаксияҳо (Ин назари оддии назарияи муосири кислотаҳо аз соли 1954 сарчашма мегирад, аммо то ҳол онро ба китобҳои дарсии стандартӣ ворид накардааст.

Баррасии кислотаҳо (UNC-Chapel Hill) як муолиҷаи паймонеро барои асосҳои ҳисобҳои кислотаи асосӣ пешниҳод мекунад.

Симулятори титратсияи кислотаҳо - ин саҳифаи ба осонӣ истифодашаванда ба шумо имкон медиҳад, ки як қатор системаҳои кислотаи асосиро, аз ҷумла системаҳои полипротикиро омӯзед. Инчунин интихоби истифодаи усулҳои "соли аввал" ё тавозуни масса вуҷуд дорад.

Назарияи атом

Атомҳо ва ҷадвали даврӣ — аз шаш боб дар курси якум аз назарияи асосии квантй, спектрхои атомй, конфигурацияхои электронй, давраи химиявй ва ташкили чадвали даврй. Қисми С.К. Поёни Китоби дарсии виртуалии химияи умумӣ.

Атомҳои асосӣ: атомҳо, элементҳо ва изотопҳо - муолиҷаи муқаддимавӣ барои донишҷӯёни ибтидоӣ, ки барои қисми аввали курси химияи умумӣ мувофиқ аст. (SK Lower, Донишгоҳи Саймон Фрейзер)

Муқаддима бо сохтори электронии атомҳо ва молекулаҳо - як силсилаи хуб ташкилшудаи саҳифаҳо, ки ба пайванди кимиёвӣ паҳн мешаванд. (Алфред Бадер, МакМастер У)

Пример фаъол аст Назарияи квантии атом - Маҷмӯи саволҳои зуд-зуд додашуда дар шакли катехизми квантӣ.

Визуалии мадори атомӣ - бубинед Орбитрон: галереяи орбиталҳо -- ва инчунин истинодҳо дар саҳифаи визуализатсияи мо.

Муқаддима ба атомҳо - Намоиши мухтасари принсипҳо (аз ҷумла назарияи квантӣ) бо баъзе печутоби ҷолиб. Ҷон Денкер

Асрори материя: Ҷустуҷӯи унсурҳо — Ин Видеои PBS " як силсилаи ҳаяҷонбахши се қисм аст, ки дар бораи яке аз саргузаштҳои бузург дар таърихи илм: ҷустуҷӯи тӯлонӣ ва давомдор барои фаҳмидани ҷаҳон аз чӣ иборат аст. Се эпизоди соатӣ дар бораи ҳафт олими муҳимтарини таърих ҳикоят мекунад, ки онҳо мекӯшанд блокҳои асосии сохтмонии материяро муайян, дарк ва ба тартиб оранд.

Шикор кардани унсурҳо - Видеои дусоатаи PBS/NOVA. "Маҷмӯи биноҳои табиат, ки онро элементҳо меноманд, аз куҷо пайдо мешаванд? Онҳо ҷузъҳои пинҳонии ҳама чиз дар ҷаҳони мо мебошанд, аз карбон дар бадани мо то металлҳои смартфони мо. Барои кушодани асрори онҳо, Дэвид Погу, шореҳи технологӣ ва мизбони фаъоли силсилаи машҳури NOVA "Making Stuff", тамошобинонро дар ҷаҳони химияи аҷиб ва шадид мегардонад: қавитарин кислотаҳо, марговартарин заҳрҳо, фаровонтарин унсурҳои коинот ва нодиртарин нодир — моддаҳое, ки дар зарбаҳои атомӣ пухта мешаванд, ки танҳо дар як сония ба вуҷуд меоянд." Шарҳ: ин видео дар Канада (ва эҳтимол дар дигар кишварҳо) бо сабаби мушкилоти аблаҳонаи "ҳуқуқ" намоиш дода намешавад.

Пайвастшавии кимиёвӣ

Ҳама дар бораи пайвастагии кимиёвӣ (Steve Lower, SFU) - ин сайти 10-бахш фарогирии амиқи ҳама чизеро, ки шумо дар бораи сохтори молекулавӣ ва пайвастагӣ дар сатҳи химияи умумӣ медонед, таъмин мекунад. Бахшҳои алоҳида дар бораи ковалентии қутбӣ, VESPR, орбиталҳои гибридӣ, орбиталҳои молекулавӣ, комплексҳои координатсия ва металлҳоро дар бар мегирад.

Пайванди кимиёвӣ - чизи воқеан асосӣ! (С. Поён, Саймон Фрейзер У.)

Моделҳои пайвастагии химиявӣ - Оё пайвандҳои кимиёвӣ воқеан вуҷуд доранд? Ҳеҷ кас ҳеҷ гоҳ онро "надидааст" аз ин рӯ беҳтарин чизе, ки мо карда метавонем, сохтани моделҳост. Ин аст хулосаи мухтасари онҳое, ки шумо бояд дар бораи онҳо донед.

Ковалентӣ, ионӣ ё чӣ? Бо пайванди ковалентӣ, ионӣ ва металлӣ ва омехтаҳои онҳо. Кафолат дода мешавад, ки ба шумо нисбат ба китоби дарсии шумо фаҳмиши бештаре диҳад!

Модели туннели электронии пайванди химиявӣ Чӣ тавр он диаграммаҳои электронии нуқта, ки электронҳои муштаракро нишон медиҳанд, хушбахтона нишаста метавонанд байни ядроҳо ба принсипи он ки зарядҳои муқобил ҷалб мекунанд, мувофиқ бошанд? Модели дар ин ҷо тавсифшуда соддатаринест дар ҳақиқат пайвандро мефаҳмонад, аммо шумо гумон аст, ки онро дар ягон китоби дарсӣ пайдо кунед!

Назарияи VSEPR - Ин хулоса бо дастрасии осон ба бисёр тасвирҳо як версияи гиперматни боб дар ин мавзӯъ аз китоби дарсии Марк Виннтер (У Шеффилд) мебошад.

VSEPR барои химияи умумӣ - Ин сайти Донишгоҳи Purdue дорои маҷмӯи муфиди мушкилоти таҷрибавӣ мебошад ва плагини боркаши CHIME-ро талаб мекунад.

Электрохимия

Газхо

Хусусиятҳои газҳо: моддаҳои соддатарин - шаш қисмати "Китоби дарсии виртуалӣ" дар бораи ҳолати газии материя аз ҷониби Стив Лоуэр. Намунаҳои сершумори татбиқи назарияи молекулавии кинетикӣ ва қисматро дар бораи газҳои воқеӣ дар бар мегирад. (Қисми китоби дарсии виртуалии Chem1)

Қувваҳои байнимолекулавӣ

Таъсири мутақобила байни воҳидҳои молекулавӣ - ин дастур барои донишҷӯёни соли аввал ба аттракционҳои ионӣ, ван дер Ваалс ва қувваи такони универсалӣ ва чӣ гуна онҳо ба хатҳои эҳтимолии энергетикӣ оварда мерасонанд, дида мебароянд. (Қисми китоби дарсии виртуалии Chem1)

Кинетика

Кинетика ва динамикаи химиявӣ - Муқаддима бо суръати реаксия, қонунҳои суръат, давраи нимтаъминкунӣ, энергияи фаъолсозӣ, муодилаи Аррениус ва механизмҳои реаксия. (Китоби дарсии виртуалии Chem1)

Чонг Чие дар U of Waterloo (Канада) саволҳои тестиро бо ҷавобҳо дар бар мегирад. (≤ 2010)

Explorer Kinetics - муқаддима ба омӯзиши кинетикаи химиявӣ дар асоси таҳқиқи падидаҳои динамикӣ. Якчанд симулятсияҳои хубро дар бар мегирад. (Коллеҷи Сент Олаф)

Молҳо, формулаҳо ва ҳисобҳои реаксия

Мувозинат кардани муодилаҳои химиявӣ - ин сайти ChemTeam истинодҳо ва машқҳои сершуморро пешкаш мекунад.

Оксидшавӣ - камшавӣ

Фурӯпошии электрон. Самти реаксияњои оксидшавї-резиширо чї тавр пешгўї кардан мумкин аст. Муҳокимаи силсилаи фаъолияти элементҳо ва оксидшавӣ-камшавии мубодилаи моддаҳо. (S.K. Lower, SFU)

Реаксияҳои реаксияҳо (UNC-Chapel Hill) Хулосаи хуби тарзи мувозинати реаксияҳои оксидкунӣ инчунин потенсиалҳои ҳуҷайра ва қонунҳои Фарадейро дар бар мегирад.

Химияи ядрой

Саргузашти заррачаҳо: асосҳои материя ва қувва. Ин сайти Лабораторияи Миллии Лоуренс Беркли ба шумо имкон медиҳад, ки ҷаҳони зарраҳо ва қувваҳои бунёдиро омӯзед ва сипас далелҳо ва усулҳои таҷрибавиро таҳқиқ кунед.

Мари Кюри ва девонаи Радиум - (видео PBS) "Пас аз кашфи радиум аз ҷониби Мари ва Пьер Кюри, қобилияти аҷиби элементи нав барои дурахши дар торикӣ як девона дар саросари ҷаҳонро илҳом бахшид - шитоби маҳсулоти аз радий басташуда, ки ваъда медод, ҳама чизро аз беқувватӣ то рехтани мӯй табобат мекунад. Он чизе, ки кам одамон фаҳмиданд, ва Кюриҳо намехостанд эътироф кунанд - зарари бузурге буд, ки ин унсури радиоактивӣ метавонад расонад.

Ҷадвалҳои даврӣ

Барои футболкаҳои ҷадвали даврӣ, гарданбандҳо ва ғ., нигаред ба ин ҷо

> - рӯйхати бузург, вале хуб ташкилшудаи ҳар як намуди имконпазири ҷадвали даврии шумо метавонед дар бораи он, инчунин бозиҳо, нармафзор ва ғайра (& le 10/2006)

Ҷадвали даврии Калиди Visual ва Quantum Fold - Ин ҷадвали даврии такмилёфта аз ҷониби доктор Эрик Скерри, муаллифи Ҷадвали даврӣ: Ҳикоя ва аҳамияти он, аз рӯи аккоратсия мекушояд "to намунаҳои пинҳоншударо нишон медиҳад, ки онҳоро дар китобҳои дарсӣ ва диаграммаҳои деворӣ дидан мумкин нест." Онро аз ин сайт бо нархи 10 доллари ИМА харидан мумкин аст.

Ҷадвали даврии видеоҳо - Ин на танҳо ҷадвали даврии навбатӣ, балки як манбаи бузургест, ки беш аз 500 видеоро дар бар мегирад, ки асосан хеле кӯтоҳ аст. Дар соддатаринаш, шумо танҳо як элементро клик мекунед ва видеои ду дақиқаиро тамошо мекунед, ки унсур ва истифодаи онро тавсиф мекунад. Инчунин як силсилаи калонтари "Видеоҳои молекулавӣ" вуҷуд дорад ки моддаҳои гуногуни кимиёвӣ ва истифодаи онҳоро тавсиф мекунад - ҳама барои интиқол додани шавқу ҳаваси химия пешбинӣ шудаанд. Аксари ин наворҳо як устоди химияи Донишгоҳи Ноттингеми Британияи Кабир Мартин Полиакофф, ки ин лоиҳа дар он ҷо асос ёфтааст, нақш мебозад.

Ҷадвалҳои даврии Чин — Бале, чунин чизхо хастанд! , ва ин мақолаи Википедияро бубинед, ки чанд намуна дорад.

Ҷадвали даврии китоби комикс - Агар комиксҳо ва химия дар ҳаёти шумо муҳим бошанд, шумо инро дӯст медоред!

Ҷадвали даврии фотографии элементҳо - саҳифаи хонагӣ аксҳои (ё ба он алоқаманд) унсурҳоро дар бар мегирад, аммо он "ҳазорҳо саҳифаҳои матн, ҳикояҳо, расмҳо ва маълумот" аз Теодор Грейро дар бар мегирад.

Ин Elemental аст - ин на он қадар ҷадвали даврӣ аст, ҳамчун як қатор истинодҳо ба мақолаҳои олӣ ва ҷолиб, ки ба таърих ва истифодаи ҳар як унсур, ки аз ҷониби муаллифони дорои таҷрибаи махсус ё таваҷҷӯҳ ба ин элемент навишта шудаанд. Ин маҷмӯаи мақолаҳо бо шеваи публитсистикатар аз илмӣ навишта шуда, дар нашри вижаи 80-солагии Р. Хабарҳои кимиёвӣ ва муҳандисӣ.

Ҷадвали даврии iPod - хуб, ин аслан тамоми ҷадвал нест, балки танҳо як пойгоҳи додаи унсурҳои қулай барои нигоҳ доштани мусиқии шумо.

Суруди мнемоникии чадвали даврй -

Ҷадвали даврии шеър "Кимиё ва назм мисли пештара якҷоя."

Элемтимология ва Элементҳои Multidict — Элементро чй мегуянд стронций дар Гурҷистон (кишвар, давлат не!)? Ҷавоб: სტორცინიუმი. Агар ганҷҳои ба ин монанд шуморо мафтун кунанд, ба ин сайт нигаред, ки дар бораи пайдоиши номҳои элементҳо на танҳо ба забони англисӣ, балки бо 97 забони гуногун.

Ҷадвали даврии Ҳайку — барои онхое, ки унсурхои лирикиро пайдо мекунанд.

WebElements (Шеффилд, Британияи Кабир) Элементҳо дар ин ҷадвали даврии онлайн бо як қатор маълумоти химиявӣ ва физикӣ, инчунин замина, кристаллографӣ, ядроӣ, электронӣ, биологӣ ва геологӣ алоқаманданд. Шумо ҳамеша метавонед бишнавед, ки бритониёиҳо номи элементро чӣ гуна талаффуз мекунанд!

Рақамҳои муҳим

&гт Рақамҳои назаррас ва яклухткунӣ: Чӣ гуна бояд аз дурӯғгӯӣ бо рақамҳо худдорӣ кард. Бо мисолҳои зиёд шарҳи фаҳмо ва амиқ медиҳад. Бо мисолҳои зиёд шарҳи фаҳмо ва амиқ медиҳад. (S.K. Lower, Китоби дарсии виртуалии Chem1)

Маводи сахт ва мавод

Омузиши олами нано - Ин сайти олиҷаноб аз ҷониби Гурӯҳи таълимии байнисоҳавӣ дар U Wisc-Madison, ки аз ҷониби NSF маблағгузорӣ мешавад, нигоҳ дошта мешавад. Он намунаҳои нанотехнология ва маводи пешрафтаро барои омӯхтани консепсияҳои илм ва муҳандисӣ асосан дар сатҳи коллеҷ истифода мебарад, аммо барои K-12 бахшҳо низ мавҷуданд. Истинодҳо ба филмҳо, таҷрибаҳои лабораторӣ, маҷмӯаҳо (аз ҷумла nanobricks Lego) ва маводи таълимӣ мавҷуданд.

Ҷисмҳои сахти ионӣ ва ионӣ - баррасии муфассали энергетика ва сохторҳои алкали галогенӣ ва сохторҳои васеъ. (Қисми китоби дарсии виртуалии Chem1)

Муқаддима ба кристаллҳо - чӣ гуна шаклҳои берунии кристаллҳо бо сохторҳои дохилии онҳо алоқаманданд. Қонунҳои эмпирикии кристалҳо, торҳо ва ҳуҷайраҳои воҳидҳо, индексҳои Миллер ва омилҳоеро, ки ба одатҳои афзоиш таъсир мерасонанд, фаро гиред. (Қисми китоби дарсии виртуалии Chem1)

lattices булӯр мукааб ва бастабандии наздик - пайдоиши тартиби дарозмуддат дар ҷисмҳои сахт. Сохторҳои ба чеҳра нигаронидашуда ва ба бадан нигаронидашуда. (Қисми китоби дарсии виртуалии Chem1)

Таҳқиқи муҳандисии мавод - истинод ба сайтҳои мухталифи марбут ба мавод ва илми полимерӣ.

Бакиболлс (Buckminsterfullerenes, он сохторҳои карбон ба тӯби футбол монанд). Ин Ҳоло нанотехнология сайт шарҳи хубе дорад нанотубҳо ва Бакиболҳо ва бисёр пайвандҳо.

Полимерҳо. Сайти барҷаста Макрогалерия сохтор ва хосиятҳои полимерҳоро ба таври ғайриоддӣ ҷалб мекунад. Хеле тавсия.

Термодинамика

Энергетикаи кимиёвӣ: дар бораи энтальпия, термохимия ва Конуни якуми термодинамика - Ҷонишини васеъ, амиқ, вале асосан ғайри риёзӣ барои табобати муқаррарии (ва хеле борик) китобҳои дарсӣ. С.К. Поён, Донишгоҳи Саймон Фрейзер

Термодинамикаи мувозинат: ҳама дар бораи энтропия, энергияи озод, Қонуни дуюми термодинамика ва чаро баъзан реаксияҳо ба амал меоянд—. С.К. Поён, Донишгоҳи Саймон Фрейзер.

<Саҳифаи EntRopY> - экспозицияи хеле фаҳмо аз ин мавзӯи душвор аз ҷониби Дейв Славен аз Сагинав Водии иёлати У.

Қонуни дуюм: Бузургтарин, тавонотарин ва умумӣтарин идея дар тамоми илм. Намоиши ҷолиб ва ғайриматематикии он, ки энергияи энтропия ва фаъолсозӣ бо он дар ҷаҳон, тавре ки мо медонем, мубориза мебарад. Аз ҷониби Франк Ламберт аз Коллеҷи Оксидентал. Варианти алтернативӣ, ки ба донишҷӯёни ғайриилмӣ ва калонсолон равона шудааст, низ дастрас аст. Ҳамчунин ба тавсифи ғайритехникии Ламберт нигаред, ки чӣ гуна энергияҳои фаъолсозӣ татбиқи Қонуни дуюмро тағир медиҳанд. Ҳамчунин нигаред ба Шекспир ва Термодинамика: Сарбанд Қонуни дуюм ва Энтропия оддӣ аст. Агар мо аз часбҳои Briar канорагирӣ кунем!.

Қонуни дуюми термодинамика, эволютсия ва эҳтимолият. Мефаҳмонад, ки чӣ гуна инкишоф ва таҳаввулоти ҳаёт бо принсипи он, ки энтропияи ҷаҳон ҳеҷ гоҳ кам намешавад, мувофиқат мекунад.

Келвин Худованд аст !! Ҳама ҳамду сано лорд Келвин! Як сайти таблиғ барои термодинамикӣ майл.

Воҳидҳо ва омилҳои табдилдиҳӣ

Воҳидҳо ва андозаҳо барои химия - диаграммаҳоеро дар бар мегирад, ки диапазони шкалаҳоро нишон медиҳанд, ба монанди дарозӣ, масса, ҳарорат ва ғайра, ки дар химия муҳиманд.

Воҳидҳо, ченакҳо ва табдилҳо маълумотро дар як қатор манбаъҳо ёфтан мумкин аст:

  • Ҷадвали омилҳои табдили Википедиа барои онҳое, ки дар ботлоқи воҳидҳои ғайри SI-и ИМА ғарқ шудаанд, хуб аст - як дастури хуб дар бораи чӣ гуна анҷом додани математикаи табдили воҳидҳо
  • Ин саҳифаи Numericana дорои маҷмӯаи эклектикии воҳидҳо, аз ҷумла баъзе ҷузъҳои нодир аст.
  • Барои онҳое, ки ба аркан таваҷҷӯҳ доранд: воҳидҳои ченкунии кӯҳна ва қадимӣ

101 Саволу ҷавоб - Дар ин ҷо шумо ҳатман саволҳои ҷолибе хоҳед ёфт, ки шумо ҳеҷ гоҳ дар бораи додан фикр накардаед!

Чӣ тавр ман онро ҳал кунам? Ин саҳифаи олиҷаноб аз Purdue U. истинодҳоро ба дастурҳо барои ҳалли бисёре аз мушкилоти маъмулии миқдорӣ, ки дар химияи умумӣ дучор мешаванд, идома медиҳад.

Танҳо аз Антуан пурсед - Агар инструктори шумо ҷавоб надошта бошад, дар ин ҷо кӯшиш кунед! Аз ҷониби Фред Сенезе аз Донишгоҳи давлатии Фростберг (MD) дар доираи "Project Antoine" гузаронида мешавад.

Нютон: Аз як олим пурсед - як ҷомеаи онлайн барои муаллимон ва донишҷӯёни илм, математика ва информатика. НЬЮТОН аз ҷониби Лабораторияи Миллии Аргон идора карда мешавад.

Санҷишҳои таҷрибавии химияи AP - Маҷмӯаи зиёди санҷишҳои таҷрибавии ройгон, ки мавзӯъҳои зиёдеро дар сатҳи AP фаро мегиранд.

Кластери химия як гурӯҳи Yahoo аст, ки дар он шумо метавонед саволҳо диҳед (ё ҷавоб диҳед!).

Форуми химиявӣ барои донишҷӯёни химия - ҷое, ки шумо метавонед саволҳо ва ҷавобҳоро ҷойгир кунед. Форумҳои алоҳида барои химияи мактаби миёна, химияи умумии коллеҷ, органикӣ, аналитикӣ, химияи физикии ядроӣ ва ғайриорганикӣ ва биологияи кимиёвӣ ва ғайра мавҷуданд. Бақайдгирӣ талаб карда мешавад, аммо он ройгон аст.

Форумҳои ChemiCool сайти дигаре аст, ки дар он шумо метавонед саволҳо ва ҷавобҳоро оид ба химияи умумӣ ва биохимия, инчунин химияи органикӣ, назариявӣ ва ҳисоббарорӣ ҷойгир кунед.

Крамстер тахтаи дигар барои "chemistry help" бо имтиҳонҳои таҷрибавӣ, иқтибосҳо аз китобҳои дарсӣ ва саволҳои аз ҷониби корбар фиристодашуда мебошад.

химияи мағзи сар - боз як сайти дигар барои саволҳо ва ҷавобҳо аз химия

Муаллимони фанни химия барои ичора - Шумо метавонед ин сайти WyzAnt-ро барои ҷустуҷӯи мураббиёни маҳаллӣ, баррасии профилҳо ва тахассусҳо, тафтиши замина ва ташкили дарсҳои хонагӣ истифода баред.

Вазни атомии даҳ элементи химиявӣ дар бораи тағирёбанда - ва шумо фикр мекардед, ки вазнҳои атомӣ абадӣ ҳастанд? Ин хабари декабри 2010-ро аз Хадамоти геологии ИМА бубинед!

Химияи тозакунӣ - шарҳи хуб дар бораи табиати "dirt" ва агентҳое, ки аз он халос мешаванд. Дигар манбаи муфид: саҳифаи York U. (Бритониё). Модҳои шустушӯй чӣ гуна кор мекунанд?" якчанд таҷрибаҳои оддиро оид ба футури собун ва шиддати рӯизаминӣ пешкаш мекунад. Химия паси тозакунӣ дорои бисёр истинодҳои муфид ба сайтҳои дигар.

Дастури нест кардани доғ - Тақрибан ҳар намуди доғеро, ки шумо дар бораи он фикр карда метавонед, чӣ гуна нест кардан мумкин аст.

Илми пухтупаз - Сайти хуб тарҳрезишуда аз осорхонаи илмии Exploratorium дар Сан-Франсиско. Истинодҳо ба мавзӯъҳо аз нон то бодиринг кӯмак мекунанд, ки фаҳмиши илми паси ғизо ва пухтупазро беҳтар созанд.

Видеоҳои илми ғизо - маҷмӯи хуби видео

- Ин сайт аз Осорхонаи Австрия равандҳои табиии химиявӣ ва биологиро тасвир мекунад, ки оқибат бо ҳамаи мо рӯй медиҳад. [Ин сайт соли 2008 фавтидааст, истинод ба версияи охирини бойгонӣ аст]

Химияи сафедаҳои тухм - як муолиҷаи ғайриоддӣ хуб ба ин мавзӯъ.

Чӣ тавр пухтан тухм - ҳама дар бораи тухм ва илми ҷӯшонидани онҳо аз ҷониби Чарлз Вилямс (U Exeter, UK)

Сохтори яхмос - ҳама дар бораи химия ва физикаи тӯҳфаи дӯстдоштаи шумо аз факултети илми ширии Донишгоҳи Гуэлф (Онтарио, Канада)

Дастури нест кардани доғ - Ин ҷо чизест, ки волидонатон шуморо ҳамчун мутахассиси химия медонанд!

&гт Химияи Spray Skunk — бӯйи калон дар чист? Дар дорупошии skunk чӣ мавҷуд аст ва шумо дар ин бора чӣ кор карда метавонед? Ин саҳифа аз ҷониби W.FD. Вуд аз иёлати Ҳумболдт U (CA) ҳама чизро нақл мекунад.

Чаро пӯсти ман сабз шуд? Чӣ гуна ҷавоҳиротро аз ранг кардани пӯсти шумо нигоҳ доред.

Чаро хӯрдани морҷӯба бӯи пешобатонро хандаовар мекунад? - Дӯстони худро бо фаҳмиши сирри нанговари онҳо ба ҳайрат оред! Барои маълумот дар бораи дигар моеъҳои нафратовар ва бӯи бадан, аз сайти Grossology санҷед.

Чаро чизҳо ранг мешаванд?

Чаро осмон кабуд аст? Шарҳи соддакардашуда - Шарҳи мукаммали тавсифи парокандагии Рэйли.

Викторинаи донишҳои илмӣ - "Тавассути тести кӯтоҳи 12 саволи мо дониши худро дар бораи далелҳои илмӣ ва татбиқи принсипҳои илмиро санҷед. Пас бубинед, ки шумо дар муқоиса бо гурӯҳи намояндагии миллии 3,278 калонсолони ба таври тасодуфӣ интихобшудаи ИМА, ки аз 11 август то 3 сентябри соли 2014 дар интернет ва тавассути почта пурсиш шуда буданд, ба сифати аъзои Pew Research Center&rsquos American Trends Panel."

Химия шарҳ медиҳад: Асосҳо ва барномаҳо - Дар назари аввал, ин сайт танҳо як шохиси AZ ба як қатор таърифҳои кӯтоҳи мавзӯъҳои зиёде аст, аммо клик кардани номи мавзӯъ худ тавсифи хеле муфассал (вале беном тартиб дода шудааст) меорад. ё намоиши мавзуъ.

&гт <Муносибати A то E ба ҳалли масъалаҳо дар химия> аз ҷониби Дэвид Вудкок. Силсилаи дастурамалҳо дар формати веб-саҳифа, ки чӣ гуна муносибат карданро ба масъалаҳои химияи умумӣ тавсиф мекунанд. (Сайти аслӣ кайҳо нест, аммо ин маслиҳати бойгонӣ то ҳол донистан меарзад!)

&гт Блогнависӣ дар ҷадвали даврӣ - "Силсилаи квотаҳои 28 "Ҳикояҳои ваҳшӣ, аҷиб ва аҷиб дар бораи унсурҳое, ки олами моро ташкил медиҳанд" аз ҷониби Сэм Кин. Ин силсила дар нимаи соли 2010 дар Slate пайдо шуд.

Химия барои чӣ муфид аст? (Такрори хубе барои онҳое, ки химияро дар ифлос кардани ҷаҳон айбдор мекунанд.)

Бозёфтҳои элементарӣ Маҷаллаи ҳарҳафтаина, ки мавзӯъҳо ва баррасиҳои химияро дар бар мегирад.

Эмульсияҳо ва пухтупаз — Ин Илм дар ошхона саҳифа нақши эмульсияҳоро дар шир, либосҳои салат, равған ва равғани чормағз баррасӣ мекунад.

Чӣ тавр нон кор мекунад -Шумо шояд ҳар рӯз нон мехӯред. Шумо ҳатто медонед, ки чӣ тавр нони худро худатон созед. Аммо оё шумо боре дар бораи нон фикр кардаедтехнология?

Термодинамикаи инсон - ин сайти хеле дур аз афташ мекӯшад, ки наздикии кимиёвиро бо ҳамкории одамон алоқаманд кунад.

Химияи чӯб - видеои 6-дақиқаӣ аз Донишгоҳи Глазго дар бораи ин модда дар ҳама ҷо.

Табдилдиҳандаи ченак - омилҳои табдилдиҳӣ байни воҳидҳои SI ва cgs ҳама намудҳо, ки ҳам аз рӯи категория ва ҳам номи воҳид ташкил карда шудаанд. OnlineConversion.com як сайти шабеҳ аст.

Галереяи минералӣ — Хуб минерология сайт бо маълумот ва аксҳои аълои шумораи зиёди канданиҳои фоиданок ҳам аз рӯи ном ва ҳам аз рӯи гурӯҳбандӣ ташкил карда шудааст.

Илмҳои псевдосӣ чист? Ҳама дар бораи псевдосология, илми бад ва илми патологӣ. Фарқиятро аз илм чӣ гуна метавон гуфт. Агар шумо ба илм шавқ дошта бошед, шумо бояд чизе дар бораи сафсатаҳое, ки ба номи илм тозиёна мекунанд, бидонед. (S.K. Lower, Донишгоҳи Саймон Фрейзер)

Об ба шароб: Асоси молекулавии тағирёбии ранги нишондиҳанда. Сомонаи хеле хуб сохташуда бо графикаи ҷолиб ва истинодҳои зиёде. Хеле хонданашаванда ва ҷолиб, дар сатҳи "Scientific American" муқаррар карда шудааст ва барои курсҳои ибтидоии мактаби миёна ва коллеҷ мувофиқ аст.

Оби ҷӯшон бе футур - мақолаи ҷолиб дар бораи нанозарраҳо ва эффекти Leidenfrost.

Ҷон Оливер дар бораи "таҳқиқоти илмӣ" ва гузориши онҳо — А Ҳафтаи гузашта Имшаб Видеои YouTube дар бораи он, ки чӣ гуна ва чаро расонаҳо маълумоти бардурӯғ ё нопурраро ҳамчун илм гузориш медиҳанд.

Викторинаҳои химиявӣ - ин сайт дастрасӣ ба викторинаҳои гуногунро аз сарчашмаҳои гуногун фароҳам меорад.

Юмори химия

Химия шӯхӣ-а-рама - аз ҷониби Ҷамъияти кимиёвии Амрико кафолат дода шудааст, ки шуморо ханда кунад.

Молекулаҳо бо номҳои беақл ё ғайриоддӣ (ё пешниҳодкунанда). - як сайти шавқовар ва иттилоотӣ аз ҷониби Пол Мэй аз Бристол У (Бритониё), ки эҳтимолан барои наврасони ҳама синну сол ҷолибияти хоса дорад.

Юмори илмӣ WebRing - баъзеи онҳо хеле ҷӯшон аст.

"Манъи DHMO" (оксиди дигидроген) саҳифа. Он метавонад шуморо бикушад! Ҳама чиз дар бораи ин кимиёвӣ дар муҳити мо.

Хавфи илм! Бозиҳо - ин сайти U Pittsburgh умумӣ, органикӣ, аналитикӣ ва биохимияро фаро мегирад.

Либосҳо ва лавозимоти марбут ба химия

Ба ҷаҳон нишон диҳед, ки химия барои шумо муҳим аст! Инҳоянд чанд таъминкунандагони ИМА футболкаҳои ҷадвали даврӣ ва дигар сухбат-хои бузург.

Cotton Expressions якчанд футболкаҳои хуби химия, биология ва геологияро пешниҳод мекунад.

Бо молекулаҳо сохта шудааст Ин рассоми олим, ки ба молекулаҳо шавқ дорад, ҷавоҳироти нуқрагии мавзӯи молекулавӣ, занҷирҳо, тӯҳфаҳои кӯдакон, кортҳои идона ва барои бачаҳо шортҳои бокси тестостерон пешниҳод мекунад.

Панели дастгоҳи атомӣ - ин манбаи интерактивии химия ва воситаи омӯзиш аст, ки барои Mac аз ҷониби Bitwixt Software Systems таҳия шудааст. Аз ҷониби омӯзгорон, донишҷӯён, олимон ва одамони оддӣ истифода мешаванд. Бо китобхонаи молекулаҳои 3D ва моделҳои 3D-и орбиталҳои атомӣ, молекулаҳо, пайвастагиҳо, газҳо ва кристаллҳо, панели Atomic ба шумо дар омӯхтани муносибатҳои байни рафтори атомҳо ва молекулаҳо ва сохтори 3D онҳо кӯмак мекунад. Mac App Store, $15.

CurTiPot - Барномаи ройгон барои ҳисобҳои мувозинати рН ва кислотаи асосӣ ва моделсозӣ ва
таҳлили Потэнтиометрӣ Титрация Курвас

Intelli Balancer - ин барномаи зеркашишавандаи танҳо дар Windows қариб ҳама муодилаҳои кимиёвиро барои шумо мувозинат мекунад.

Atomic Mac як пойгоҳи додаҳои даврии ба ҷадвал нигаронидашуда, аз ҷумла маълумотҳои изотопӣ ва ядроӣ) оид ба элементҳо мебошад. Инчунин ҳисобкунаки вазни молекулавӣ дорад.

Атом дар қуттӣ як барномаи shareware Macintosh аст, ки орбиталҳои атомиро дар вақти воқеӣ намоиш медиҳад.

Screensaver унсурҳои кимиёвии 3D инчунин як барномаи интерактивии Ҷадвали даврӣ ва моделсозии 3D Atom мебошад. $20 ва танҳо барои Windows.

Linux4химия саҳифа як қатор замимаҳои химияро номбар мекунад, аз ҷумла манбаи кушода, ройгон ва нармафзори shareware

Консепсияи созандаи Chem1 барои химияи умумӣ - ҳоло ройгон!
Ин маҷмӯи дарсҳо, ки дастурҳои ҳидоятшаванда ва интерактивиро аз фанни химияи умумӣ дар коллеҷ ва сатҳҳои мактаби миёна пешкаш мекунанд. Ин маводҳо барои омӯзиши хонагӣ ё ҳамчун илова ба курси расмӣ мувофиқанд. Ҳама дарсҳо аз сатҳи хеле ибтидоӣ оғоз мешаванд ва бисёре аз онҳо то андозае аз мундариҷаи курси стандартии соли аввал берун меоянд ва онҳоро барои донишҷӯёне, ки дар курсҳои химияи аналитикӣ, биохимия ва химияи экологӣ номнавис шудаанд, муфид мегардонанд. Windows 3.1 то XP.

Ҳисобкунаки рН ChemBuddy рН-и ҳама гуна омехтаи кислотаҳо ва асосҳои қавӣ/заиф/полипротикиро бо қувваи ионӣ ё ислоҳи қобилият ё бидуни ислоҳ ҳисоб мекунад ва метавонад хатҳои титратсияро кашад. Он инчунин дорои махзани васеи маълумот оид ба кислотаҳо / асосҳо мебошад.

Барномаи тарҳрезии сохтори химия

Draw Symyx як барномаи ройгони танҳо барои Windows мебошад, ки шумо метавонед онро барои кашидани сохторҳои кимиёвӣ ва содироти онҳо барои дидани моделҳои 3D истифода баред. Symyx Draw вориси Isis/Draw аст, ки дигар дастрас нест.

ACD/ChemSketch як барномаи ройгон барои истифодаи ғайритиҷоратӣ барои Windows ё Linux мебошад, ки оптимизатсияи 3D, тамошо ва гардиш, буридан ва часбондан ба дигар замимаҳо ва пешгӯии тавтомерро пешниҳод мекунад.

&гт ChemDraw " нармафзори стандартии соҳавӣ мебошад, ки аз ҷониби олимон дар саросари ҷаҳон барои кашидани сохторҳои дақиқ ва аз ҷиҳати кимиёвӣ огоҳ барои истифода дар дархостҳои пойгоҳи додаҳо, омода кардани графикаи сифати нашр, воридшавӣ барои моделсозӣ ва дигар барномаҳое, ки тавсифи электронии молекулаҳо ва реаксияҳоро талаб мекунанд." Версияҳо инҳоянд. ҳам барои Windows ва ҳам Mac-OS дастрас аст ва тахфифи амиқ барои донишҷӯён дастрас аст.

EasyChem як барномаи ройгони бисёрплатформаи GPL мебошад, ки сохторҳои сифатии нашрро ҷалб мекунад.file:///Users/slower/Web/ChemEd/genchem.shtml

iMol як барномаи ройгони визуализатсияи молекулавӣ барои Mac OS X системаҳои амалиётӣ. iMol якчанд форматҳои файлро дастгирӣ мекунад. Он метавонад ба осонӣ молекулаҳои хурду калонро идора кунад, молекулаҳои сершуморро бор кунад, онҳоро мустақилона ҳаракат ва гардиш кунад ё траекторияи динамикаи молекулавиро нишон диҳад.

Сарчашмаҳои нармафзори ройгони моделсозии молекулавӣ дар номбар шудаанд Сайти MathMol -

Нармафзори ройгон аз силсилаи нармафзори JCE Journal of Education Chemical ҳоло дастрас аст. Мушкилот: он пеш аз Windows (DOS) аст, аммо баъзеи он хеле хуб аст.

Нармафзори Trinity Тахфифҳои донишҷӯёнро дар ҳама маҳсулоти худ пешниҳод мекунад, ки як қатор унвонҳоро дар химияи умумӣ дар бар мегиранд.

Ҳисобкунакҳои муфид барои химия

Донишҷӯён: шумо оқилона мебудед, ки вобаста ба ин хидматҳо барои реҷаи курсҳои ибтидоӣ худдорӣ кунед, шумо воқеан таҷрибаи ҳалли ин мушкилотро барои худатон лозим аст!

MoleCalc озод аст ҳисобкунаки вазни молекулавӣ Утили танҳо барои Windows аз ҷониби Davd Defoort. Шумо формуларо ворид мекунед ва он вазни молекуляриро бармегардонад.

Ҳисобкунакҳои вазнҳои молекулавии ройгон аз ҷониби Мэттью Монро (танҳо дар Windows)

Онлайн Ҳисобкунаки вазни молекулавӣ аз Lenntech

Ҳисобкунакҳои МВт барои Macintosh OS X: Илми рақамӣ (дар бар мегирад истинод дар ҷадвали даврии дарунсохт) - Сохторӣ

iPhone/iPod Ҳисобкунаки MW: Ҳисобкунаки илмии Invitrogen - Формулаи онлайн ва ҳисобкунаки массаи молярӣ - LabCalPlus барои iPad

Ҳисобкунакҳои ҳалли онлайн: масса, ки маҳлули ҳаҷм ва молярияти додашударо ташкил медиҳад, маҳлули саҳроиро ба ҳаҷм ва молярияти додашуда об кунед

Нармафзори кислотаи асоси CurTiPot - Барномаи ройгони ҳама дар як барои ҳисобҳои мувозинати рН ва кислотаи асосӣ ва моделсозӣ ва таҳлили каҷҳои титратсияи потенсиометрӣ.

Модели ChemLab як моделиронӣ дар вақти воқеӣ 2-D як лабораторияи кимиё аст, ки дар он корбар бо таҷҳизоти лабораторӣ мутаҳаррикро дар шумораи зиёди модулҳои таҷрибавӣ мутақобила (ба рӯйхат нигаред.) Як нусхаи арзон барои тақрибан $25 дастрас аст. Намоиши Macintosh ва Windows Free тавассути зеркашӣ дастрас аст.

&гт MoluCAD абзори мукаммали моделсозӣ ва визуализатсияи молекулавӣ мебошад, ки барои платформаҳои компютерии шахсӣ пешбинӣ шудааст. Он бо дастгирии NSF таҳия шудааст ва барои донишҷӯён бо нархи хеле паст дастрас аст. Ҳарду версияҳои Macintosh ва Windows метавонанд зеркашӣ карда шаванд. Версияи охирин бисёр хусусиятҳои пешрафтаро дар бар мегирад, ки танҳо дар бастаҳои моделсозии гаронбаҳои истгоҳи корӣ мавҷуданд. Корбарони навкор қодиранд, ки моделҳоро зуд тавлид кунанд, онҳоро дар ҳама гуна дурнамо бубинанд, аниматсияҳои реаксия эҷод кунанд ва ҳама маълумотро дар диск захира кунанд.

Танҳо барои ашхоси Chem! Тезауруси химиявӣ Маҷмӯаи азими (200 Мб) маълумот дар бораи реаксияҳои кимиёвӣ, тағирёбии фазаҳо ва радиохимия дар пойгоҳи додаҳои релятсионӣ ташкил карда шудааст. Он барои истифодаи шахсӣ ройгон аст ва ҳам дар версияҳои Windows ва Macintosh дастрас аст.

Муодила- ва нармафзори нақшаи Функсияи

Рӯйхатро бубинед ки аз тарафи Википедиа тартиб дода шудааст

Баъзе утилитаҳои тарҳрезии функсияҳои онлайн дар асоси веб QuiSoft, FooPlot ва Zorn's Online Function Grapher мебошанд.

&нусхабардории солҳои 2004-2017 аз ҷониби Стивен Лоуер - охирин тағирот 08-08-2019

Ин кор тибқи иҷозатномаи Creative Commons Attribution 3.0 Unported License иҷозатнома дорад


Баррасиҳо

Баррасии Стив Аква, дотсенти тадқиқоти Донишгоҳи Массачусетс Амхерст 26/6/21

Он ҳамчун як китоби дарсии химияи умумӣ хеле фарогир буда, маълумоти бештар аз он чизе, ки одатан талаб карда мешавад, пешниҳод карда мешавад. Ин манбаъ метавонад барои дастгирии донишҷӯёни ихтисосҳои гуногун мутобиқ карда шавад. Гарчанде мавзуъ мувофик ва. маълумоти бештар

Баррасии Стив Аква, дотсенти тадқиқоти Донишгоҳи Массачусетс Амхерст 26/6/21

Рейтинги фарогири: 4 камтар нигаред

Он ҳамчун як китоби дарсии химияи умумӣ хеле фарогир буда, маълумоти бештар аз он чизе, ки одатан талаб карда мешавад, пешниҳод карда мешавад. Ин манбаъ метавонад барои дастгирии донишҷӯёни ихтисосҳои гуногун мутобиқ карда шавад. Гарчанде ки мавзӯи мавзӯъ дар муқоиса бо дигар китобҳои дарсӣ мувофиқ ва мувофиқ аст, ҳам версияи онлайн ва ҳам PDF бояд барои навсозии ҷиддии форматкунӣ барои истифода аз услубҳои таҳаввулшавандаи омӯзиш ва ниёз ба захираҳои босифати таълим, ки мо аз пандемия бармегардем, лозим аст. . Қабули технологияҳои таълими фосилавӣ дар давраи пандемия зарурати захираҳои дастрасии кушодро барои таълим таъкид кард ва ин китоби дарсӣ метавонист як воситаи муҳими таълим бошад. Ба ман илова кардани ҳадафҳои омӯзишӣ маъқул аст, ки ба нигоҳ доштани тамаркузи возеҳ ба бобҳо ва мавзӯъҳои такрорӣ барои пайваст кардани мафҳумҳо, ки ҷузъи муҳими омӯзиш аст, кӯмак мекунанд. Такмил додани паймоиши китоби дарсӣ то ҳол барои кӯмак ба донишҷӯён ва омӯзгорон талаб карда мешавад, аммо ҳамчун манбаи ройгон дастраси таълимӣ, потенсиали зиёд вуҷуд дорад.

Рейтинги дақиқии мундариҷа: 5

Ба назар чунин мерасад, ки мундариҷа ягон хатогие надорад, ба истиснои тасвирҳои дар ин барраси номбаршуда.

Рейтинги аҳамият/дарозиум: 4

Китоб ҳамчунон муҳим аст, зеро он ба принсипҳои асосии химия асос ёфтааст. Китоби дарсӣ аз доштани иттилооти бештар аз он чизе, ки одатан талаб карда мешавад, фоида меорад ва минбаъд равиши модулиро барои таълим дастгирӣ мекунад.

PDF ва версияи онлайни китоби дарсӣ барои хондан равшан аст. Донишҷӯён метавонанд тавассути бобҳо кор кунанд, аммо таҳрири иловагӣ ба формати баъзе саволҳо барои роҳнамоии онҳо муфид хоҳад буд.

Бисёре аз тасвирҳо рақамҳои рақамӣ надоранд, ки ин ба мувофиқати тамоми китоби дарсӣ таъсир мерасонад. Ин масъаларо дар таҳрирҳои оянда ислоҳ кардан мумкин аст, ҳангоми барқарор кардани ҷойнишинҳои тасвири гумшуда.

Бобҳои китоби дарсӣ тарҳрезии модулӣ доранд, аммо бо сабаби набудани ҷадвали мундариҷа дар PDF то ҳол мушкилот дар паймоиш вуҷуд доранд. Ба лекторҳо барои ворид кардани равиши модулӣ ба китоби дарсӣ вақти иловагӣ лозим мешавад.

Ташкил / Сохтор / Рейтинги ҷараён: 4

Ташкили китоби дарсй умуман хуб буда, усулхои гуногуни мутобик кардани мазмуни лек-цияхо ва воситахои ахбори оммавии таълимро таъмин менамояд. Боби 7 бахши хубе дар бораи аллотропҳои карбон дорад, ки ман метавонам барои презентатсияҳои виртуалии кӯтоҳ мутобиқ кунам.

Версияи PDF барои беҳтар кардани интерфейс ба кори назаррас ниёз дорад, зеро сарлавҳа метавонад ба ҷои тасҳеҳ дар саҳифаи нав барои эстетика дар охири саҳифа пайдо шавад. (Барои мисолҳо ба саҳифаҳои 61, 62 ва 87 нигаред) Тасвири расми 2.2 дар саҳифаи 97 дар таносуби дуруст нест. Варианти онлайн рақамҳои зиёде дорад, ки ҳамеша дастрас нестанд. Ин рӯйхати ҳамаҷонибаи тасвирҳои гумшуда аст: Расмҳои 1.6, 1.7, 1.8, 1.9, 1.16, 2.9, тасвир дар оғози боби 3, 3.1, 3.7, 3.9, тасвир дар мисоли 13, тасвир дар мисоли 15, тасвир дар аввали боби 4, 4.4, тасвир дар мисоли 8, тасвир дар мисоли 11, (бе рақами рақамӣ - Торик шудани кристаллҳои бромиди нуқра бо таъсири рӯшноӣ), 4.14, 4.16, 4.21, 4.23, 4.24, 5.12 , тасвири аввали боби 6, 6.9, 6.13, (бе ракам — сухтани калий), расм дар аввали боби 8, 9.27, 10.15, 10.16, 11.1, 11.10, 13.5, 13.8, 13.22, 14.2, 14.3, 14.4, 15.1, 15.12, 15.13, тасвири аввали боби 16, 16.22, 16.25, 17.4, 17.9, 17.11, 18.6, 18.7, 18.6, раками 18.7, 19. ван. , 21.11, 22.14, 23.4 ва 23.5.

Рейтинги хатогиҳои грамматикӣ: 4

Хатогиҳои грамматикие, ки ман ёфтам, бо форматкунӣ алоқаманд буданд, эҳтимол ҳангоми табдилдиҳӣ ба PDF. Умуман, дигар хатоҳои грамматикие, ки ман мушоҳида кардам, вуҷуд надорад.

Рейтинги аҳамияти фарҳангӣ: 4

Истинодҳои мушаххаси фарҳангӣ вуҷуд надоранд. Он аз дохил кардани фарқиятҳои эҳтимолии минтақавӣ дар тарзи таълими мавзӯъҳои фаннӣ ҳамчун эзоҳ манфиат хоҳад овард.

Маълум аст, ки барои ин китоби дарсй, ки дар бораи химия назари хаматарафа медихад, бисьёр вакт ва кувва сарф шудааст. Бо гузашти вақт чунин ба назар мерасад, ки версияи онлайн пайвандҳоро ба бисёре аз рақамҳо гум кардааст ва ин бояд дар таҳрири оянда баррасӣ карда шавад. Форматкунии PDF то ҳол кори зиёдеро талаб мекунад, то паймоиши донишҷӯёнро осон кунад.

Баррасии Леанна Ҷанкарло, дотсент, Донишгоҳи Мэри Вашингтон дар 30/4/19

Ин матн тамоми мавзӯъҳои асосиро дар бар мегирад, ки дар курси ду семестр, соли якуми химияи умумӣ мавҷуданд ва дорои ҷадвалҳои мувофиқ (микдорҳои термодинамикӣ, константаҳои мувозинат ва ғ.) ҳамчун замимаҳои нишондодашуда мавҷуданд. Ҷадвали коҳиши стандартӣ. маълумоти бештар

Баррасии Леанна Ҷанкарло, дотсент, Донишгоҳи Мэри Вашингтон дар 30/4/19

Рейтинги фарогири: 3 камтар нигаред

Ин матн тамоми мавзӯъҳои асосиро дар бар мегирад, ки дар курси ду семестр, соли якуми химияи умумӣ мавҷуданд ва дорои ҷадвалҳои мувофиқ (микдорҳои термодинамикӣ, константаҳои мувозинат ва ғ.) ҳамчун замимаҳои нишондодашуда мавҷуданд. Ҷадвали потенсиалҳои коҳиши стандартӣ (Замимаи E) нисбат ба аксари дигар китобҳои дарсӣ истифода бурдан душвортар хоҳад буд, зеро потенсиалҳо аз рӯи аломати алифбо номбар шудаанд. Ҷадвали даврии Замимаи H низ барои истифода хеле хурд аст. Варианти pdf дорои ҷадвали мундариҷа, индекс ё ​​луғати истилоҳот нест. Формати онлайн дар ин робита бо истинод ба бобҳо ва мавзӯъҳо дар ҷадвали мундариҷа беҳтар аст. Луғат ва индекс ҳанӯз вуҷуд надорад. Ин матн дар муқоиса бо бисёре аз дигарон аз ҷиҳати мувозинати кислотаву асоси мукаммалтар аст, зеро муаллифон барои пешниҳоди мисолҳои миқдори миқдорӣ дар мувозинат ҳам барои кислотаҳои заиф ва ҳам асосҳои заиф кори аъло доранд (охирин аксар вақт вуҷуд надоранд).

Рейтинги дақиқии мундариҷа: 3

Мундариҷаи кимиёвӣ ва риёзӣ дақиқ ба назар мерасад (гарчанде ки сохтори Люис барои карбон дар расми 8.7 нодуруст аст), аммо ақидаҳои калидӣ мавҷуданд, ки барои донишҷӯён барои арзёбии аҳамияти онҳо ба таври муфассал баррасӣ карда намешаванд. Яке аз инҳо истисноҳо дар дохили конфигуратсияҳои электронӣ мебошанд (Боби 6), ки оилаҳои Cu ва Cr танҳо дар расми 6.4 таъкид шудаанд. Таваҷҷӯҳ ба ин фарқият дар шакли муқаррарии конфигуратсияҳои электронӣ ва шарҳи он, ки чаро дар матн ё сарлавҳаи расм мавҷуд нест. Илова бар ин, ба назар чунин мерасад, ки муҳокимаи муҳофизаткунӣ кам аст.

Рейтинги аҳамият/дарозиум: 2

Мундариҷа замонавӣ нест, бисёре аз тасвирҳо ҳазф карда шудаанд ва санаи "нашр" соли 2011.

Матни хаттӣ ва стратегияҳои ҳалли мушкилот хеле равшан ва равшананд. Таърифи дақиқтари истилоҳот ба донишҷӯ ва инчунин аз байн бурдани маводи пешрафта (масалан, тавсифи функсияи мавҷи орбиталҳои молекулавӣ) кӯмак хоҳад кард. Бисёр бобҳо дорои маълумоти аз ҳад зиёди бегона мебошанд, ки диққати донишҷӯёнро ба ҳадафҳои муҳими омӯзишӣ ва ҷиҳатҳои асосии кор, ки дороиҳои кор мебошанд, душвортар мегардонад. Масалан, аз боби 1 хориҷ кардани "Унсурҳои муҳим барои ҳаёт" ва "Таърихи мухтасари химия" ё "Энментҳои микроэлементҳо дар системаҳои биологӣ" дар боби 7 ҷараёни хонандагонро беҳтар мекунад. Гарчанде ки якчанд графикҳо (масалан, Ҷадвали 2.2, 2.5 ва Расми 2.12) хеле хуб таҳия шудаанд, баъзе рақамҳо нолозиманд, ки дар айни замон онҳо дар матн ҷой доранд ё маълумотеро пешниҳод мекунанд, ки барои донишҷӯ дар ин сатҳ хеле пешрафта аст. (Масалан, расмҳои 2.3 ва 2.4 ҳангоми ворид кардани геометрияҳои электронӣ ва молекулавӣ дар боби 9 мувофиқтар хоҳанд буд ва каҷҳои титркунӣ, ки дар масъалаи консептуалии 3 боби 4.9 пайдо мешаванд, пас аз пешниҳоди мувозинати кислота/баён, буферҳо ва титратсия беҳтар мувофиқат мекунанд. дар боби 16.)

Формати китоби дарсӣ хеле мувофиқ аст: дар аксари мавзӯъҳо ҳадафи омӯзишӣ (бо қуттии ранга ҷудо карда шудааст), матн ва пас аз он мисолҳо (бо заминаҳои рангаи гуногун бо формати худпайваста таъкид карда мешаванд), муодилаҳои калидӣ (дигар ранга) мавҷуданд. замина), хулоса, хулосаи асосӣ, консепсия ва мушкилоти ададӣ (ҳарду бо ҷавобҳо). На ҳама бобҳо мушкилоти татбиқро дар бар мегиранд (дар қисмати «Материал дар охири боб»), ки дар он ба донишҷӯён бе роҳнамоии пешакӣ донистани мавзӯъ амалияи иловагӣ дода мешавад.

Матн ба қадри кофӣ хондан ва ба қисмҳои хурд тақсимшаванда аст, ки ин ба омӯзгор/донишҷӯ имкон медиҳад, ки қисматҳоеро, ки шояд бегона ба назар мерасанд, тарк кунанд ё ба малакаҳои муҳим гузаред (масалан, префиксҳои метрӣ, табдили ҳарорат, таҳияи график ва ғ.). Матн хуб ташкил карда шудааст ва бо назардошти сохтори он метавонад ба осонӣ аз нав ташкил карда шавад, то ба ҳадафҳои курс мувофиқат кунад.

Ташкил / Сохтор / Рейтинги ҷараён: 4

Ғайр аз иттилооти байниҳамдигарӣ, мавзӯъҳо ба таври мантиқӣ пешниҳод карда мешаванд, ки аз ғояҳои стандартии усул ва андозагирии илмӣ сар карда, ба сохтори элементарии атом, стехиометрия ва реаксияҳо, энергия, сохтори муфассалтари атом, тамоюлҳои даврӣ, пайвастшавӣ, шаклҳои молекулавӣ, фазаҳои модда, кинетика, мувозинат, термодинамика, электрохимия ва химияи ядроӣ.

Дар нусхаи онлайнии матн тасвирҳо мавҷуд нестанд (ба ҷои хориҷ кардани занг ба рақам, дубора рақамгузорӣ кардан дар як боб ва таҳрири матн, изҳороти узрхоҳӣ ва огоҳиҳо дар бораи ба таври доимӣ нест карда шудани тасвирҳо ворид карда шудаанд). Ин парешон буд ва ба хондан халал расонд. Варианти pdf ин изҳоротҳоро дар бар намегирад (тасвирҳо танҳо партофта шудаанд) ва матн бо ҳуруфи калонтар тозатар менамояд. Мутаассифона, дар версияи pdf асбобҳои зарурӣ (ҷадвали мундариҷа, индекс ва ғ.) ва гиперишораҳо мавҷуд нестанд, ки истифодаи файли pdf-ро ҳангоми кӯшиши гузаштан ба макони мушаххаси дохили матн мушкил месозад. Ниҳоят, андозаи ҳуруф (махсусан) дар дохили тасвирҳо / графикҳо тағир меёбад. Ин маълумотро муҳимтар аз он менамояд, ки муаллифон пешбинӣ кардаанд. (Эзоҳ: тағироти ҳуруф дар матни онлайн низ рух медиҳанд, аммо дар ин формат он камтар парешон аст.)

Рейтинги хатогиҳои грамматикӣ: 4

Матн нисбатан аз хатогиҳои грамматикӣ озод аст, аммо мувозинат одатан ҳамчун ҷамъи мувозинат истифода мешавад.

Рейтинги аҳамияти фарҳангӣ: 5

Матн аз чихати маданият бетаъсир нест.

Баррасии Сохеила Адл, лектори ассистенти LAGCC дар 15/19

Ҳам PDF ва ҳам версияҳои онлайн дорои фарогирии хуби мавзӯъҳо бо такрори нолозими ҳамон мавзӯъҳо дар бобҳои гуногун мебошанд. Масалан, муҳокимаи сохтори атом дар бахшҳои 1.4-1.7 боби 1 бештар ва камтар баррасӣ мешавад. бештар хонед

Баррасии Сохеила Адл, лектори ассистенти LAGCC дар 15/19

Рейтинги фарогири: 3 камтар нигаред

Ҳам PDF ва ҳам версияҳои онлайн дорои фарогирии хуби мавзӯъҳо бо такрори нолозими ҳамон мавзӯъҳо дар бобҳои гуногун мебошанд. Масалан, муҳокимаи сохтори атом дар бахшҳои 1.4-1.7-и боби 1 дар боби 6 бештар ва камтар баррасӣ мешавад. Боби 1-уми китоб (Муқаддима ба химия) барои хондан (барои донишҷӯён) хеле дароз ва дилгиркунанда аст, зеро он бисёр чизҳоро дар бар мегирад. мавзӯҳои ношинос барои донишҷӯёни курси якуми химияи умумӣ 1. Ба ҷои сохтори атом, ки дар бобҳои 2 ва 6 баррасӣ мешавад, таҳлили андозагирӣ (табдилдиҳии воҳидҳо) бояд дар боби 1, ки дар боби 3 ин китоби дарсӣ ворид шудааст, шинос карда шавад. Варианти PDF-и китоб Ҷадвали мундариҷа, лавҳаи паймоиш ва луғат мавҷуд нест. Нақшаи саҳифаҳои китоб дар версияи PDF бояд такмил дода шавад, то ба хондани мавод кӯмак расонад. Тасвирҳо ва графикҳо бояд дар версияи PDF низ дуруст ҷойгир карда шаванд. Дар версияи онлайн луғат низ мавҷуд нест, аммо сатри паймоиш ва Ҷадвали мундариҷа қадр карда мешавад. Гарчи инъикоси мавзуъхои китоб каноатбахш бошад хам, ман тартиби мавзуъхоро дар баъзе бобхо тагйир дода, материалхои ба хамдигарро бархам медодам. Масъалаҳои форматкунии версияи PDF ва ташкили мавзӯъҳо дар баъзе бобҳо мутобиқсозии ин китоби дарсиро ҳамчун китоби мустақили таълимӣ мушкил месозад.

Рейтинги дақиқии мундариҷа: 4

Баъзе истилоҳоте, ки Муаллифон истифода кардаанд, партофта шуда, онҳоро муаллифони охирини китобҳои химияи умумӣ иваз кардаанд. Масалан, дар боби 5, фасли 5.3 зери таснифи реаксияҳои химиявӣ, 3 синфи реаксияҳои кимиёвӣ ҳамчун мубодила, конденсатсия ва тақсимшавӣ номгузорӣ шудаанд, ки дар аксарияти химияи умумии охирин мутаносибан ивазкунӣ (дугона ё ягона), омехта ва таҷзия маълуманд. китобхо. Ҳарчанд он истилоҳоте, ки дар ин китоб истифода шудаанд, дурустанд, онҳо замонавӣ нестанд ва агар ин китоби дарсӣ дар якҷоягӣ бо дигар китоби химияи умумӣ истифода шавад, метавонад боиси иштибоҳ дар байни донишҷӯён гардад. Умуман, китоб бо дақиқии хуб навишта шудааст.

Рейтинги аҳамият/дарозиум: 5

Принсипҳои бунёдии химия то ҳол бетағйир ва мувофиқанд ва мундариҷаи китоб муосир аст. Ман дар бораи дурустии таърихи химия боварӣ надорам. Онро дар асоси фактхои хакикии таърихй хаматарафа санчидан лозим аст. Бо ҳама забонҳои барномасозии компютерӣ, ба монанди html, j query ва дигар абзорҳои барномасозӣ, ки аллакай ҳам дар PDF ва ҳам дар версияи онлайни ҳар як китоб амалӣ шудаанд, илова кардан, таҳрир кардан ва навсозии ҳама гуна китоби дарсӣ осон аст.

Матн хеле равшан ва мувофиқ аст, аммо муаллифон майл доранд, ки баъзе мавзӯъҳоро аз ҳад зиёд шарҳ диҳанд, ки таваҷҷӯҳи хонандаро гум мекунад. Услуби мухтасар ва равшани хаттӣ ҷолибтар хоҳад буд. Он ба донишҷӯён кӯмак мекунад, ки моҳияти мавзӯъҳоро тавассути нишон додани ҳисобҳои қадам ба қадам бо истифода аз Муҳаррири муодилаҳо дарк кунанд. Аз таҷрибаи шахсии худ ман медонам, ки донишҷӯён барои фаҳмидани мушкилоти таҳлили андозагирӣ душворӣ мекашанд, агар ҳалли онҳо бо формати мувофиқ нишон дода нашавад.

Китоби дарсӣ аз ҷиҳати истилоҳот ва услуби истифодашуда, услуби навиштан ва пешниҳоди мавзӯъҳо комилан мувофиқ аст. мутаассифона, мушкилоти форматкунӣ махсусан бо версияи PDF ва тасвирҳои гумшуда ба мувофиқати китоби textbook.y таъсир мерасонанд

Набудани ҷадвали мундариҷа ва сатри навигатсионӣ дар версияи PDF пайдо кардани мавзӯи мушаххасро душвор мегардонад. барои версияи онлайн, ба истиснои боби аввал, дар тамоми китоби дарсӣ модулияти боэътимод вуҷуд дорад. Илова кардани рақами саҳифа ва сарлавҳа дар болои саҳифаҳо барои нишон додани боби мушаххас тавсия дода мешавад.

Ташкил / Сохтор / Рейтинги ҷараён: 4

Ман версияи онлайнро барои ташкили он 4 баҳо додам. PDF аз сабаби масъалаҳои тарҳрезӣ ва форматкунӣ чунин дараҷаи созмонро надорад.Агар ман ин китоби дарсиро мутобиқ карданӣ бошам, ман бешубҳа тартиби баъзе мавзӯъҳоро барои якчанд боб тағир медиҳам, то он бо барномаи таълимии худ мувофиқ бошад.

Варианти PDF ба тағири ҷиддии формат ниёз дорад. Варианти онлайн ба луғат, рақами саҳифа, сарлавҳа барои нишон додани боби дахлдор ниёз дорад ва тасвирҳои гумшуда бояд ислоҳ карда шаванд. Дар болои сатри паймоиш қабати саҳифаҳои ҳаракаткунанда мавҷуд аст, ки онро барномасози компютерӣ ислоҳ карда метавонад.

Рейтинги хатогиҳои грамматикӣ: 4

Ман ба хатогиҳои грамматикӣ дучор наомадаам, аммо дар версияҳои PDF ҳолатҳои зиёди хатогиҳои имлоӣ, ки дар натиҷаи бартараф кардани фосила байни калимаҳо ба вуҷуд омадаанд, мавҷуданд. Масалан, саҳифаи 57 дар версияи PDF, ки фосила байни ду калимаи пайдарпай бартараф карда шудааст.

Рейтинги аҳамияти фарҳангӣ: 5

Ин як китоби химия аст ва комилан беғараз аст.

Варианти онлайни китоби дарсӣ фарогирии хуби ин мавзӯъро дорад ва ман фикр мекунам, ки онро ба донишҷӯёни худ ҳамчун варианти сарфаи пул муаррифӣ кунам. Тартиби мавзӯҳо дар чанд боб ва набудани масъалаҳои дурусти форматкунӣ барои ман камбудиҳои асосӣ дар мутобиқсозии ин китоби дарсӣ барои таълими худ мебошанд. Ҳамин тавр, ман кӯшишҳои муаллифонро барои таҳияи ин китоби дарсӣ хеле қадр мекунам.

Баррасии Майкл Рассел, профессори химия, Коллеҷи Ҷамъиятии Mt.Hud дар 11/9/18

Ин китоб асосҳои курси химияи соли аввалро дар бар мегирад, аммо дар он амиқ ва "хондан" мавҷуд нест. Дарвоқеъ, ин матн наметавонад ҳамчун як варианти мустақили таълим истифода шавад. Кисми якуми китоб «Мукаддима ба химия» кори одилона дорад. маълумоти бештар

Баррасии Майкл Рассел, профессори химия, Коллеҷи Ҷамъиятии Mt.Hud дар 11/9/18

Рейтинги фарогири: 4 камтар нигаред

Ин китоб асосҳои курси химияи соли аввалро дар бар мегирад, аммо дар он амиқ ва "хондан" мавҷуд нест. Дарвоқеъ, ин матн наметавонад ҳамчун як варианти мустақили таълим истифода шавад. Қисми якуми китоб, "Муқаддима ба химия" дар бораи усули илмӣ, аҳкоми асосии химия ва таърихи химия баҳси одилона дорад, аммо ман муҳокимаи рақамҳои муҳимро пайдо кардам (мавзуъе, ки ба андешаи ман барои аввалин планхои таълимии химия) аз чихати тафсилот ё хачми нокифоя. Инчунин, китоби дарсӣ аз расмҳо ва ҷадвалҳои иловагӣ, ҳама чизест, ки барои шикастани якрангии абадии калимаҳои дар матн истифодашуда фоида меорад. Ман вақтеро, ки барои эҷоди чунин китоб сарф шудааст, хеле қадр мекунам, аммо тафсилоти хурд ба хонанда (ва донишҷӯи химия) хеле фоиданок хоҳад буд.

Рейтинги дақиқии мундариҷа: 5

Хангоми азназаргузаронии матн ба ягон хатою носахехие дучор наомадаам.

Рейтинги аҳамият/дарозиум: 5

Китоби дарсӣ соли 2011 навишта шуда буд, аз ин рӯ, то ба имрӯз, китоб хеле мувофиқ ба назар мерасад. Навсозӣ, чун ҳамеша, қадр карда мешавад!

Дар матн услуби насри хондашаванда истифода шудааст. Гарчанде ки хеле ҳаяҷоновар нест, он хеле равшан ва мувофиқ аст…. хонандаи муайяншуда метавонад ба итмом расонад ва таҷрибаи қаноатбахш пайдо кунад.

Матн аз лиҳози истилоҳот ва чаҳорчӯби худ хеле мувофиқ аст. Ман таърифҳои такроршаванда ё истисноҳоро ба бахшҳои қаблӣ ва ғайра надидам.

Ба истиснои боби аввал, ман матнро ба осонӣ ба қисмҳои хурдтар тақсим кардам. Ин дар як курси семинар ё шояд курси як бахши мушаххаси химия хеле муфид хоҳад буд…. хеле сард. Бо вуҷуди ин, боби аввал - ва эҳтимолан муҳимтарин - ба назар мерасад, ки дар як кластери ҷудонашаванда якҷоя мешавад…. ва ин шармовар аст: агар ман мехостам дар бораи рақамҳои муҳим сухан гӯям, хуб мебуд, ки ин бахш(ҳо)-ро ба ҳуҷҷати нав нусхабардорӣ ва часбонед" барои мубодила бо синф ва ғайра. ба ман як китоби дарсии дуюм лозим аст, то ин китобро такмил диҳам, агар ман онро барои дарсҳоям қабул кунам. Ман мефаҳмам, ки варианти тақсимшавандаи матн салоҳияти муаллифон аст, аммо хуб мебуд, ки чунин хусусият дастрас бошад.

Ташкил / Сохтор / Рейтинги ҷараён: 5

Матн ба таври мантиқӣ ва хеле равшан ташкил карда шудааст. Формат пешрафтҳои муқарраршударо, ки аз ҷониби дигар муаллифони китобҳои дарсии химия муқаррар карда шудаанд, пайравӣ мекунад…. Барои муаллимоне, ки ин китобро барои дарсҳои худ қабул мекунанд, ҳеҷ гуна монеаи ҷиддӣ вуҷуд надорад.

Ман хеле ҳайрон шудам, ки ибтидои китоби дарсӣ дар версияи PDF мундариҷаи мундариҷа надорад. Вебсайт ва версияи онлайн дорои ҷадвали мундариҷа буд.... версияи PDF аз рӯйхати бобҳои гуногун ва ғайра манфиати калон хоҳад дошт. Инчунин, барои баланд бардоштани хониши мавод, илова кардани расмҳои рангоранг, диаграммаҳо, ҷадвалҳо ва мисолҳо олиҷаноб мебуд: матн дар айни замон хеле хушк аст, ки Ман ҳайратовар меёбам, зеро мавод аз ҳайрат ва тарс пур аст.

Рейтинги хатогиҳои грамматикӣ: 5

Ман дар матн ягон хатогиҳои ошкор ё равшанро надидам.

Рейтинги аҳамияти фарҳангӣ: 5

Матн ба "the" ё "she" такя накардааст ва аксаран бетарафи гендерӣ боқӣ мондааст. Ман дар матн чизе надидам, ки нажодҳо, этникҳо ва миллатҳои мушаххасро истисно кунад.

Ман кӯшишҳои зиёди муаллифонро барои эҷоди ин матн қадр мекунам ва мехоҳам ба онҳо барои мубодилаи кори худ дар ин арса ташаккур гӯям - ташаккур! Агар шумо ягон бор тасмим гиред, ки версияи навро нависед (ё агар шумо нияти қабули ин китобро барои дарсҳои худ дошта бошед), хуб мебуд, ки баъзе маълумотро дар соли 2011 низ дохил кунед, ИЛТИМОС ҷадвали мундариҷаро дар версияи PDF-и китоби дарсӣ. Илова кардани расмҳои иловагӣ, диаграммаҳо, ҷадвалҳо ва ғайра таҷрибаи хонандаро хеле равшан мекунад. танҳо як идея. Дар маҷмӯъ, ин китоб ба ман маъқул аст ва бо дарназардошти баъзе иловаҳо ва тағирот, он ҳам олӣ хоҳад буд.

Баррасии Габриэл Бэкс, омӯзгори химия, Коллеҷи ҷамъиятии Портланд 12/9/18

Матни онлайн ҳамаҷониба аст ва ҳама мавзӯъҳоеро дар бар мегирад, ки дар барномаи таълимии умумии химияи яксола заруранд. Он хуб ташкил карда шудааст ва дар усули анъанавӣ гузошта шудааст. Ҳар як боб дорои графика ва тасвирҳо мебошад. маълумоти бештар

Баррасии Габриэл Бэкс, омӯзгори химия, Коллеҷи ҷамъиятии Портланд дар 12/9/18

Рейтинги фарогири: 4 камтар нигаред

Матни онлайн ҳамаҷониба аст ва ҳама мавзӯъҳоеро, ки дар барномаи таълимии умумии химияи яксола заруранд, баррасӣ мекунад. Он хуб ташкил карда шудааст ва дар усули анъанавӣ гузошта шудааст. Ҳар як боб дорои графика ва тасвирҳо мебошад, гарчанде ки тасвирҳои зиёде мавҷуд нестанд - ҳамчун ҳамеша дастрас нестанд. Ин махсусан дар боби 14 (Кинетика) бо норасоиҳои хурд тақрибан дар ҳар боб равшан аст. Масъалаҳои хурдтарини форматкунӣ дар боби 16.2 аз қисмати ба таври дигар хеле зебо навишташуда (ё дар маҷмӯъ матн) парешон мекунанд. / Ҳар як боб инчунин маҷмӯи машқҳои охири бобро дар бар мегирад. Ман фикр мекунам, ки матн бешубҳа метавонад аз машқҳои иловагӣ ва инчунин илова кардани як қисмати машқҳои душвор муфид бошад. / Матн замимаи хеле мукаммалро бо тамоми ҷадвалҳо ва маълумоти зарурӣ дар бар мегирад. / Ба ман писанд омад, ки ҳар як бахш бо “ҳадафи омӯзиш” кушода мешавад ва бо “барои асосӣ” анҷом меёбад. / Матн бешубҳа бо дигар матнҳое, ки барои курси химияи ихтисос пешбинӣ шудаанд, хуб муқоиса мекунад. Мутобиқсозии матн барои истифода дар ҳама курсҳои химияи умумӣ бешубҳа имконпазир аст.

Рейтинги дақиқии мундариҷа: 5

То ҷое ки ман метавонам доварӣ кунам, мундариҷа дақиқ аст ва ман ба ягон камбудии ҷиддӣ ё тасаввуроти нодуруст дучор нашудаам.

Рейтинги аҳамият/дарозиум: 5

Матн тавре тартиб дода шудааст, ки ҳангоми зарурат ба ҳар як бахш илова кардан хеле осон хоҳад буд. Дар айни замон, замимаҳо дар дохили матн ҷорӣ мебошанд ва метавонанд барои муддати тӯлонӣ истифода шаванд (расми 2.22 албатта бояд нав карда шавад). Ман мехоҳам, ки боз чанд рӯйдодҳои ҷорӣ, рақамҳо, ҷадвалҳо ё истинодҳо ба рӯйдодҳои ҷорӣ, ки дар матн бофта шудаанд, бубинам. / Ҳама гуна навсозиҳо, ки бояд бо мурури замон ба амал оянд, метавонанд ба осонӣ муттаҳид карда шаванд ва набояд ба ҷараёни матн таъсир расонанд.

Китоб хуб навишта шудааст, мухтасар ва мазмуни онро пайгирӣ кардан осон аст.

Матн дар тарҳрезӣ, форматкунӣ ва услуби навиштанаш хеле мувофиқ аст.

Кифоя. Ҳар як боб метавонад ба осонӣ ҳамчун як боби алоҳида қабул карда шавад

Ташкил / Сохтор / Рейтинги ҷараён: 5

Китоби химия барои инъикоси тартиби анъанавии мавзӯъҳо навишта шудааст. Ман ҳис мекунам, ки тарҳ дар баробари табиати китоб имкон медиҳад, ки ҳар гуна тағиротро фароҳам оранд, агар тартиби дигари мавзӯъҳо он чизест, ки барномаи таълимӣ мехоҳад.

Ман барраси кардани версияи онлайнро интихоб кардам (ба ҷои зеркашии pdf). Навигатсия дар матн бо истифода аз компютери ман осон буд ва ман бо ягон мушкили боркунии тасвирҳо дучор наомадаам. Баъзе аз тасвирҳо нисбатан хурд ба назар мерасанд ва ман дар ҳайрат будам, ки онҳо дар планшет ё IPad хурдтар чӣ гуна хоҳанд буд (ки бисёре аз донишҷӯёни ман аз он истифода мебаранд). Инчунин, ҳама бобҳо истинодҳое доранд, ки ба бобҳои қаблӣ бармегарданд, аммо ҳеҷ яке аз истинодҳо дар компютери ман кушода нашудааст.

Рейтинги хатогиҳои грамматикӣ: 5

Ман ягон хатогии грамматикӣ ё имлоӣ наёфтам.

Рейтинги аҳамияти фарҳангӣ: 5

Ин матни химия аст. Ман ягон масъалае наёфтам.

Ин китоб хеле зебо навишта шудааст ва пайравӣ кардан осон аст. Мундариҷа дақиқ, матн ҳамаҷониба аст ва онро дар барномаи таълимии химияи умумӣ ба осонӣ истифода бурдан мумкин аст. Ин як китоби бузурги онлайни химия аст ва ман бешубҳа дар бораи қабули он барои курсҳои умумии химияи мо дар оянда фикр мекунам. Аммо, дар айни замон, он барои истифода комилан омода нест, зеро мушкилоти форматкунӣ ва бисёр тасвирҳои гумшуда мавҷуданд, ки аз матни ба таври дигар хеле хуб навишташуда парешон мекунанд.

Баррасии Алвин Ҳолдер, дотсент дар химия, Донишгоҳи Олд Доминион дар 20/6/17

Матн барои ба донишҷӯёни биологӣ ва биотиббӣ, донишҷӯёни муҳандисӣ, донишҷӯёни таҳсилоти умумӣ, донишҷӯёни илмҳои тандурустӣ, донишҷӯёни пеш аз тиб ва ихтисосҳои илме, ки ҳадди аққал як сол дар химияи умумиро талаб мекунанд, пешбинӣ шудааст. маълумоти бештар

Баррасии Алвин Ҳолдер, дотсент дар химия, Донишгоҳи Олд Доминион дар 20/6/17

Рейтинги фарогири: 3 камтар нигаред

Матн барои ба донишҷӯёни биологӣ ва биотиббӣ, донишҷӯёни муҳандисӣ, донишҷӯёни таҳсилоти умумӣ, донишҷӯёни илмҳои тандурустӣ, донишҷӯёни пеш аз тиб ва ихтисосҳои илме, ки ҳадди аққал як сол дар химияи умумиро талаб мекунанд, пешбинӣ шудааст ва матн тамоми маводи заруриро дар бар мегирад. мавзӯъҳо барои иҷрои ин вазифа. Ин китоби дарсӣ барои донишҷӯёне, ки химияи органикии I-ро меомӯзанд ва он донишҷӯёне мебошад, ки пас аз курсҳои якум ва дуюм бояд химияи пешрафтаи ғайриорганикӣ омӯзанд, ҳатто бахши қаблӣ табиатан хеле кӯтоҳ аст. Дар шакли мультфильм/ ракамхо бисьёр материалхои хавасмандкунанда мавчуданд, вале баъзе сифати онхо мувофики талаб нест. Дар матн ҷадвали мундариҷа, индекс ё ​​луғат мавҷуд нест ва набудани ин воҳидҳо камбудии ҷиддӣ аст. Баъзе масъалаҳои хеле ҷиддии форматкунӣ вуҷуд доранд, ки шояд натиҷаи табдил аз формати .doc ё .docx ба формати .pdf бошад ва ин хатогиҳо қисматҳои ин матнро нохонда мекунанд. Варианти онлайн дар баъзе ҷойҳо огоҳӣ дорад, яъне: “Бубахшед! Тасвир ба таври доимӣ дастрас нест." Омӯзгор бояд барои ислоҳи ин хатогиҳои формат вақти зиёд сарф кунад ва барои таълими мавод вақти хеле кам боқӣ мемонад. Инчунин мушкилоти форматкунӣ бо зерхаттҳо дар формулаҳои кимиёвӣ вуҷуд доранд, ки ҳамчун зерхатраҳо пайдо намешаванд, боз як масъалаи форматкунӣ. Ин масъала дар версияи pdf бартарият дорад, ки дар он касрҳо нишон дода намешаванд. Барои муаллифон аз муҳаррири муодилаҳо барои навиштани муодилаҳои математикӣ ва истифода бурдани ChemDraw барои сохторҳо ва муодилаҳои асосӣ (пас аз нигоҳ доштани файлҳо дар формати .tiff) оқилона мебуд. Варианти pdf хеле дароз аст (дар маҷмӯъ 2.365 саҳифа). Ин барои чоп хеле гарон ($$) аст ва барои хондан хеле душвор аст.

Рейтинги дақиқии мундариҷа: 3

Китоби дарсӣ дар робита бо формати дар саволи 1 дар боло зикршуда баъзе хатогиҳо дорад. Як ҳолат он аст, ки конфигуратсияҳои электронии Cr ва Cu дуруст нестанд. Дар ҳолати дигар, бузургӣ ва воҳидҳо бо фосила ҷудо карда намешаванд, масалан, 25 ° C бояд ҳамчун 25 ° C навишта шавад. Таърихи химия дақиқ НЕСТ, зеро ин дар Африқо/Миср оғоз шудааст, ки дар он ҷо химика калимаи қадимии мисрӣ барои химия аст. Таърихи химия бояд таҳқиқ мешуд, зеро таърихи химия нисбат ба аврупоиҳо нисбат ба дигар нажодҳо, ки воқеан солҳои тӯлонӣ бо химия машғуланд, хеле ғаразнок аст.

Рейтинги аҳамият/дарозиум: 5

Матн ва намунаҳои он ҳам мувофиқ ва ҳам беохир мебошанд Раванди классикии Хабер-Бош барои истеҳсоли аммиак мисол аст. Мавзӯъҳо ба монанди термохимия, электрохимия, химияи ҳастаӣ баъзе аз мавзӯъҳое мебошанд, ки ман ҳамчун донишҷӯи мактаби миёна дар Мактаби Лоҷ дар Барбадос дар солҳои 1980 омӯхтам. Чунин мавзӯъҳо солҳои зиёд дар оянда хоҳанд буд. Як чизро бояд қайд кард, агар омӯзгороне, ки ин китоби дарсиро қабул мекунанд, ба ҳуҷҷати аслӣ ҳамчун ҳуҷҷати MS Word дастрасӣ медоштанд, он гоҳ навсозиҳои зарурӣ содда ва осон хоҳанд буд, зеро таҳрири китоби дарсӣ ҳангоми табдил додани файли .pdf ба ҳуҷҷати MS Word мушкилоти зиёдеро ба вуҷуд меовард. аз сабаби нуктахои дар саволи 1 дар боло зикршуда.

Китоби дарсӣ аз ҷиҳати возеҳӣ беш аз кифоя аст, аммо баъзе ҳисобҳои намунавӣ аз форматкунии иловагӣ ҳарчи зудтар манфиат мегиранд. Беҳтар аст, ки Муҳаррири муодилаҳоро барои навиштани ҷавобҳо истифода баред ва ҷавобҳо ва муодилаҳоро сатр ба сатр нишон диҳед, ки дар он ҷо таҳлили андозагирӣ осонтар хоҳад буд. Намунаи хуб дар истифодаи ин мушкилот аст: Этанол энталпияи бухоршавӣ 42,3 кҶ/мол дорад. Ин пайвастагӣ дорои фишори буғи 1,00 atm дар 78,3 ° C мебошад. Фишори буғ дар кадом ҳарорат ба 0,500 атм баробар аст? (R = 8,314 J/K мол). Инчунин, ҳисобҳо бо фоизҳои фаровон бояд аз нав навишта шаванд. Аҳамият диҳед, ки ҳисобҳо бо молҳо, массаҳои молярӣ, истифодаи доимии Авогадро бояд ба таври беҳтар ташкил карда мешуданд. Рақами оксидшавии протон ва гидрид равшан набуд. Китоби дарсй дар баъзе сохахо, хусусан мавзуи химияи металлхои гузариш ба ислохи куллй ниёз дорад.

Китоби дарсӣ дар истилоҳот ва муаррифӣ, ҳатто бо ҳамаи хатогиҳо ва форматкунӣ дар дохили он хеле мувофиқ аст.

Набудани мундариҷаи китоб имкон намедиҳад, ки китоби дарсӣ ба осонӣ аз нав ташкил ва/ё аз нав танзим карда шавад. Ҳама мавзӯъҳои маъмулии курси химияи умумӣ мавҷуданд, аммо дорои ҷадвали мундариҷа китоби дарсӣ хеле модулӣ хоҳад буд. Шахсан, боби 8 бояд бо боби 2 муттаҳид карда мешуд. Ҳама мавзӯъҳо ва масъалаҳои термохимиявӣ бояд дар як боб бошанд. Боби дорои пайвандҳои ковалентӣ ва ионӣ бояд дар якҷоягӣ бо сохторҳои нуқтаҳои Люис пешниҳод карда мешуд. Боби муайянтар оид ба мафҳумҳои риёзӣ бояд боби аввал бошад, ки логарифмҳо, индексҳо, аломатҳои стандартӣ ва рақамҳои муҳим ва баъзе таҳлили мухтасари оморӣ иборат аст.

Ташкил / Сохтор / Рейтинги ҷараён: 2

Чунин ба назар мерасад, ки муаллифон барои курси умумии химия, ки дар гузашта таълим дода буданд, афзалиятҳои созмон / сохтор / ҷараёни худро бартарӣ додаанд! Ин матн бояд тавре навишта шуда буд, ки танзим кардани мундариҷа ба афзалиятҳои инструктори мушаххас хеле осон бошад. Ба ҷавоби ман ба саволи 6 нигаред. Баъзе аз мавзӯъҳо метавонистанд аз нав ташкил ва муттаҳид шаванд, зеро баъзе аз онҳо ҷудо шудаанд. Боби охирине, ки химияи органикиро дар бар мегирад, баррасӣ карда шуд ва ба назар чунин менамуд, ки барои сохтани як китоби дарсии ҳамаҷониба шитоб мекарданд.

Оддӣ карда гӯем, дар форматкунии муодила (ҳам химиявӣ ва ҳам риёзӣ) хатогиҳои аз ҳад зиёд мавҷуданд, то ин матн қобили истифода бошад. Ба ҷавоби ман ба саволи 1 нигаред.

Рейтинги хатогиҳои грамматикӣ: 2

Дар китоби дарсӣ як хатои грамматикӣ мавҷуд аст, ки дар он муаллифон пайваста ҷумлаҳоро бо калимаи «зеро» оғоз кардаанд. Барои муаллифон оқилона мебуд, ки як хонандаи забони англисӣ ин китоби дарсии онлайнро мутолиа кунад ва ин ва ҳама хатогиҳои грамматикиро ислоҳ кунад. Мо бояд олимони ояндаи STEM дастнависҳо ва китобҳои дарсӣ нависанд, ки аз хатогиҳои грамматикӣ холӣ бошанд.

Рейтинги аҳамияти фарҳангӣ: 5

Ин китоби дарсии химия аст, ки барои ҳама нажодҳо хеле муфид хоҳад буд, зеро химия як илми универсалӣ аст.

Ҳамчун як омӯзгор дар як муассисаи густурдаи тадқиқотӣ ва таълимӣ, ки шумораи зиёди ақаллиятҳо (34%) ва шумораи зиёди донишҷӯёни насли аввал ва собиқадорони ҳарбӣ доранд, хароҷоти таҳсил дар коллеҷ як масъалаи муҳим аст. Ҳамин тариқ, мо дар ODU ҳамеша роҳҳои паст кардани арзиши таҳсили онҳоро бидуни созиш дар сифат меҷӯем. Ман хеле ба ҳаяҷон омадам, ки дар бораи Китобхонаи кушодаи дарсӣ ҳамчун як усули кам кардани арзиши китобҳои дарсӣ шинос шудам ва умедворам, ки ин китоби дарсӣ талаботи чунин донишҷӯёнро қонеъ мекунад. Мутаассифона, дар айни замон, аз сабаби мушкилоти ҷиддии форматкунӣ ва тарзи пешниҳоди мундариҷа, ман наметавонам ин матнро ба устодоне, ки дар сатҳи якум дарс медиҳанд, тавсия диҳам. Агар дар оянда мушкилоте, ки ман дар ин барраси зикр кардам, ислоҳ шаванд, ман омодаам ин китоби дарсиро ба кафедраи химия ва биохимияи Донишгоҳи Олд Доминион тавсия диҳам.

Баррасии Криста Нишида, ассистенти клиникии Донишгоҳи давлатии Вашингтон дар 20/6/17

Ду версияи ин матн вуҷуд дорад, версияи онлайн ва версияи pdf, бо фарқияти назарраси сифат байни онҳо. Варианти pdf дорои ҷадвали мундариҷа, луғат, замима ё индекс нест, ки онро хеле душвор мегардонад. маълумоти бештар

Баррасии Криста Нишида, ассистенти клиникии Донишгоҳи давлатии Вашингтон дар 20/6/17

Рейтинги фарогири: 3 камтар нигаред

Ду версияи ин матн вуҷуд дорад, версияи онлайн ва версияи pdf, бо фарқияти назарраси сифат байни онҳо. Варианти pdf дорои ҷадвали мундариҷа, луғат, замима ё шохис нест, ки паймоишро бениҳоят душвор мегардонад ва ҷанбаи истиноди китоби дарсиро дар канор мегузорад. Варианти онлайн, аз тарафи дигар, ҳамаи ин чизҳоро дар бар мегирад ва мувофиқи ҷадвали мундариҷа пайравӣ мекунад. Назорати онлайн ба шумо имкон медиҳад, ки ба боб/фасли қаблӣ, боб/бахши оянда ё ба ҷадвали мундариҷа баргардед, ки паймоишро хеле осон мекунад.

Рейтинги дақиқии мундариҷа: 3

Боз ҳам, байни версияи онлайн ва версияи pdf фарқият вуҷуд дорад. Варианти онлайн дуруст формат карда шудааст, то ки муодилаҳо ва ҳисобҳои математикӣ мувофиқат кунанд ва ҳама аломатҳо, аломатҳои болоӣ ва ғайра дуруст нишон дода шаванд. Ин форматкунӣ дар версияи pdf гум шудааст, ки пайравии мисолҳоро ҳатто ҳамчун профессор дар ин мавзӯъ душвор мегардонад. Ин масъалаҳои дақиқ танҳо аз сабаби форматкунӣ дар версияи pdf татбиқ мешаванд. Ҳангоми хондани версияи онлайн ман ягон маълумоти нодуруст, ҳисобҳо ё муодилаҳоро наёфтам.

Рейтинги аҳамият/дарозиум: 4

Азбаски мафҳумҳои химияи умумӣ тағир намеёбанд, ман мушкилоти дарозумрӣ намеёбам.Мисолҳои овардашуда ба ҷаҳони воқеӣ мувофиқанд ва бо чизҳое, ки донишҷӯён беҳтар фаҳмида метавонанд, мувофиқат мекунанд. Ягона масъала он форматкунонӣ хоҳад буд, ки барои версияи pdf навсозиҳои зарурӣ хоҳанд буд.

Худи матн равшан ва хуб навишта шудааст, аммо боз ҳам, форматкунӣ дар версияи pdf фаҳмидан ва пайравӣ карданро душвор мегардонад. Боз ҳам, версияи онлайн хеле беҳтар аст, аммо ман интизор шуда наметавонам, ки ҳамаи донишҷӯёни ман барои хондани китоби дарсии худ онлайн хоҳанд монд.

Терминология ва чаҳорчӯба мувофиқ аст. Ман дар тарзи пешниҳоди мавод ё истилоҳоти истифодашуда ягон тағйироти ҷиддие наёфтам.

Версияи онлайнро ба қисмҳо ё қисмҳои хурд тақсим кардан осон аст ва ба шумо имкон медиҳад, ки қисмҳои гуногунро дар лаҳзаҳои гуногун таъин кунед. Варианти pdf имконнопазир хоҳад буд, зеро ҷадвали мундариҷа вуҷуд надорад ва он озмоиш ва хатогӣ бо паймоиши зиёд барои фаҳмидани куҷо буданатон аст. Нишондиҳандаҳо ё тамғакоғазҳои иловагии рақамҳо ё бобҳо вуҷуд надоранд, ба ҷуз дар аввали ҳар як боб ё бахш. Агар мисолҳо ё машқҳо дар бахшҳо ва бобҳо бо боб ва бахш рақамгузорӣ шуда бошанд, ин корро хеле осонтар мекунад.

Ташкил / Сохтор / Рейтинги ҷараён: 5

Мавзӯъҳо бо тартиби мантиқӣ барои барномаи таълимии маъмулӣ ба илм нигаронида шудаанд. Ҷараён хуб аст.

Навигатсия ва интерфейс дар версияи онлайн хуб аст. Он ба хонанда имкон медиҳад, ки клик кунад, то ба боб/бахши қаблӣ ё пеш ба оянда, инчунин ба ҷадвали мундариҷа баргардад, ҳама бо як клик аз менюе, ки дар болои равзана мемонад. Баъзан, вақте ки шумо дар байни мисолҳои коршуда бо муодилаҳо ё ҳисобҳо ҳаракат мекунед, он менюи навигатсионии боло намоён мешавад, аммо шумо онро пахш карда наметавонед. Вақте ки шумо аз он минтақаҳо дур мешавед, ин масъала қатъ мешавад. Дар версияи онлайн инчунин тасвирҳо ва рақамҳо мавҷуданд, ки ҳамчун "ба таври доимӣ дастнорас" нишон медиҳанд. Паймоиши версияи pdf хеле душвор аст ва набудани форматкунӣ матнро бо ҳам омехта мекунад ва хондан душвор ва якранг аст. Тасвирҳое, ки дар версияи онлайн "ба таври доимӣ дастнорас" ҳастанд, дар версияи pdf намоиш дода мешаванд, аммо ҳама форматкунии муодила ва ҳисобкунӣ онҳоро водор месозад, ки дар як сатри дарози аломатҳо бо гум шудани ҳама гуна форматкунии LaTeX ё html нишон дода шаванд.

Рейтинги хатогиҳои грамматикӣ: 5

Ман ягон хатогии назарраси грамматикиро наёфтам.

Рейтинги аҳамияти фарҳангӣ: 3

Дар ҳоле ки ман чизеро наёфтам, ки аз ҷиҳати фарҳангӣ бетаъсир ва ё таҳқиромез бошад, ман низ чизе наёфтам, ки умуман фарҳанги инсониро нишон диҳад.

Дар ҳоле ки матн ва мундариҷаи умумии китоби дарсӣ дар ҳарду версия якхела аст, версияи онлайнӣ нисбат ба версияи pdf китоби дарсӣ хеле беҳтар аст. Варианти онлайн чанд масъала дорад, ба монанди тасвирҳо/рақамҳои гумшуда, аммо форматкунӣ ва осонии паймоиш ин чанд мисолро ҷуброн мекунанд. Набудани формати версияи pdf, мундариҷа, луғат, индекс ва замимаҳо онро як китоби дарсӣ корношоям мекунад. На ҳама ба интернет 24/7 пайвастанд, аз ин рӯ, то он даме, ки версияи pdf ба версияи онлайн мувофиқат накунад, ман инро бо донишҷӯёни худ истифода намебарам.

Баррасии Ҷеффри Бодвин, профессори химияи Донишгоҳи давлатии Миннесота Мурхед 21/8/16

Дар версияи .pdf китоби дарсй шохис ё лугат мавчуд нест. Китоби дарсӣ ҳама мавзӯъҳои асосии курси химияи умумиро дар бар мегирад, инчунин баъзе мавзӯъҳои иловагии маъмултаринро дар бар мегирад. маълумоти бештар

Баррасии Ҷеффри Бодвин, профессори химияи Донишгоҳи давлатии Миннесота Мурхед 21/8/16

Рейтинги фарогири: 3 камтар нигаред

Дар нусхаи .pdf китоби дарсй шохис ё лугат мавчуд нест. Китоби дарсӣ ҳама мавзӯъҳои асосиро, ки ба курси химияи умумӣ хос аст, дар бар мегирад, инчунин баъзе аз мавзӯъҳои бештар маъмул, ки баъзан дар сурати мавҷуд будани вақти кофӣ фаро гирифта мешаванд. Гарчанде ки матнро барои калимаҳои калидӣ ба осонӣ ҷустуҷӯ кардан мумкин аст, аммо набудани индекс ё ​​луғат барои донишҷӯ истифодаи ин китоби дарсӣро душвор мегардонад, агар онҳо бо мавзӯъ ба қадри кофӣ шинос набошанд, то тавонанд калимаҳои калидиро барои ҷустуҷӯ интихоб кунанд.

Рейтинги дақиқии мундариҷа: 4

Чунин ба назар мерасад, ки мундариҷа аз рӯи ҳадафаш дақиқ аст, аммо хатоҳо ва нокомиҳо дар версияи .pdf китоби дарсӣ боиси иштибоҳ мешаванд (ё тафсири як донишҷӯи сатҳи ибтидоӣ) дар як қатор бобҳо.

Рейтинги аҳамият/дарозиум: 4

Намунаҳои китоби дарсӣ ҳам замонавӣ ва ҳам ҷорӣ буда, омехтаи хуби "Ин чӣ гуна кашф шуд?" ва "Мо инро ҳоло чӣ гуна истифода мебарем?" ариза барои донишҷӯ. Амалисозии навсозиҳо бо назардошти хусусияти статикии формати .pdf метавонад душвор бошад, аммо бояд идорашаванда бошад.

Матни ин китоби дарсӣ равшан навишта шудааст ва бояд барои донишҷӯёни сатҳи ибтидоӣ дастрас бошад.

Истилоҳот ва садои китоби дарсӣ мувофиқ аст, ҳарчанд бисёре аз хатогиҳои форматкунӣ ва техникӣ метавонанд дар ин мувофиқат мушкилот эҷод кунанд. Масалан, ба ҳолатҳое нигаред, ки дар он "delta" истифода мешавад ё зерхатҳо ва аломатҳои болоӣ истифода мешаванд.

Китоби дарсӣ бояд боэътимод модул бошад, гарчанде ки хатогиҳо истифодабариро дар ҳама гуна шакл душвор мегардонанд. Илова ба рақамҳои саҳифа, муаллифон ва/ё ношир бояд дар ҳар саҳифа гузоштани сарлавҳаҳоеро баррасӣ кунанд, ки боби мушаххаси (ва мавзӯъи) маводро ифода мекунанд.

Ташкил / Сохтор / Рейтинги ҷараён: 3

Ташкилот мувофик аст. Сохтор ва ҷараён бо хатогиҳои форматкунӣ ва техникӣ ба таври назаррас халалдор мешаванд.

Ин як мисоли ноумедкунандаи китоби дарсии кушодаи онлайн аст. Форматкунӣ хеле даҳшатнок аст, ки шумораи зиёди рақамҳои нопадидшуда, қисматҳои такрории матн, рақамҳо ё муодилаҳои бад ё нодуруст формат карда шудаанд ва мушкилоти дигар (эҳтимолан техникӣ), ки матнро аслан корношоям мекунанд. Ҳар як баррасии ҳатто рӯйпӯши матн аз ҷониби муаллифон ва/ё ношир пеш аз интишор бисёре аз ин мушкилотро ҳал мекард.

Рейтинги хатогиҳои грамматикӣ: 4

Баъзан хатогиҳои грамматикӣ ва чопӣ дар саросари ҷаҳон вуҷуд доранд, аммо онҳо ба хондани матн таъсири ҷиддӣ намерасонанд.

Рейтинги аҳамияти фарҳангӣ: 4

Рақамҳое, ки дар версияи .pdf-и ин китоби дарсӣ истифода шудаанд, амалан аз ҳеҷ гуна одамон маҳруманд. Ҳарчанд ин аз муаррифии аз ҳад зиёд ё кам будани ҳар як гурӯҳ пешгирӣ мекунад, таассуфовар аст, ки муаллифон инъикоси паҳлӯи инсонии химияро интихоб намекунанд, зеро бо ҳадафҳои зикршудаи онҳо мувофиқат мекунад, ки химия ба донишҷӯ бештар алоқаманд бошад. Ин инчунин як имкониятест, ки химикҳо ва дигар олимони гурӯҳҳои анъанавии камнамояндаро фаъолона муаррифӣ кунанд, то барои донишҷӯёне, ки китоби дарсӣ истифода мебаранд, ҳамчун намунаи намунавӣ хизмат кунанд.

Ин китоби дарсии кушод ноумедкунанда аст. Аверил дар гузашта баъзе матнҳои босифат муаллифӣ кардааст, бинобар ин ман намедонам, ки мушкилот бо муаллиф ё ношир вобаста аст ё танҳо тасодуфии тафсири нармафзор ҳангоми боргузорӣ ва зеркашии файлҳои калон. Ман гумон мекунам, ки ҳамаи тарафҳои марбут ба нашри ин китоби дарсии кушода барои маҳсулоти пастсифати пешниҳодкардаашон масъулият доранд. Саҳми ин сифати паст ба ҷомеаи кушоди китобҳои дарсӣ таъсири бад мерасонад ва ба мухолифон намунаи он чизеро, ки ба назар чунин менамояд, мундариҷаи ба таври ноустувор якҷоя кардашуда нишон медиҳад. Ман файли .pdf-и ин китоби дарсиро зеркашӣ кардам ва онро офлайн кушодам. (Ин ягона форматест, ки мустақиман аз вебсайти кушодаи китоби дарсии Донишгоҳи Миннесота дастрас аст.) Агар ин усули дастрасӣ решаи баъзе мушкилоти техникӣ/хатоҳое, ки ман мушоҳида мекунам, бошад, ман гумон мекунам, ки ҳамон мушкилот дар ҳама ҷо бо донишҷӯёне, ки мекӯшанд аз ин китоби дарсии кушод истифода баред. Ман ба вебсайти ношир рафтам ва версияи .html-и китобро беҳтар ёфтам (он дорои ҷадвали мундариҷа/индекс аст ва бисёре аз мушкилот бо рақамҳо ҳал шудаанд), аммо ин танҳо то миёнаи боби 1 лозим буд. Паёми "Мутаассифона, ин тасвир ба таври доимӣ дастнорас аст" -ро дар ҷои он чизе, ки дар расми 1.6 то 1.9 мебуд, пайдо кунед. Версияи .docx бо версияи .pdf бо бисёр (шояд ҳама) хатогиҳои якхела мувофиқат мекунад. Фалсафаи зикршудаи китоби дарсӣ дуруст аст ва ман нияти онро қадр мекунам. Муносибати ман ба химияи умумӣ шабеҳ аст ва ман як китоби дарсии боэътимод (хусусан китоби дарсии кушода), ки бо афзалиятҳои ман мувофиқат мекунад, истиқбол мекунам. Хатогиҳои техникӣ дар ин китоби дарсӣ чашмрасанд ва набояд қобили қабул бошанд. Ман истифодаи ин китоби дарсии кушодаро барои дарсҳои худ фикр намекунам ва илова бар ин, ман муаллифон, ношир ва Донишгоҳи Миннесотаро ташвиқ мекунам, ки ин мундариҷаро аз интернет хориҷ кунанд, то он даме, ки он ба таври масъулиятноктар пешниҳод карда нашавад.

Баррасии Д.К. Филбин, профессор, Коллеҷи Аллан Хэнкок 15/7/14

Матн барои хидматрасонии ихтисосҳои илм ва муҳандисӣ тарҳрезӣ шудааст, ки курси яксолаи химияи умумиро талаб мекунанд ва матн тамоми мавод ва мавзӯъҳои заруриро барои иҷрои ин вазифа дарбар мегирад. Дар муқаддима муаллифон ҳашт мавриди мушаххасро номбар кардаанд. маълумоти бештар

Баррасии Д.К. Филбин, профессор, Коллеҷи Аллан Хэнкок 15/7/14

Рейтинги фарогири: 4 камтар нигаред

<p> Матн барои хидматрасонии ихтисосҳои илм ва муҳандисӣ тарҳрезӣ шудааст, ки курси яксолаи химияи умумиро талаб мекунанд ва матн тамоми мавод ва мавзӯъҳои заруриро барои иҷрои ин вазифа дар бар мегирад. Дар муқаддима, муаллифон ҳашт ҳадафи мушаххасеро, ки мехоҳанд бо ин матн иҷро кунанд, номбар мекунанд ва ман ҳис мекунам, ки онҳо воқеан ҳадафи худро иҷро мекунанд. Матн намунаҳои сершумори ҷолиби &quotҷаҳони&quot-ро дар бар мегирад, ки аз химияи амалӣ (фейерверк ва таркиби онҳо яке аз дӯстдоштаи ман аст), ки ҳамчун &quotхукҳо&quot муассир барои ҷалби таваҷҷӯҳи донишҷӯён амал мекунанд. Ин мисолҳо дар якҷоягӣ бо намоишҳои синфӣ (намакҳои гуногун дар метанол гудохта шудаанд ва барои омӯхтани рангҳои фейерверкҳо) дар ҷалби таваҷҷӯҳи донишҷӯён самаранок мебошанд. Дар матн ҷадвали мундариҷа, индекс ё ​​луғат мавҷуд нест ва набудани онҳо барои донишҷӯён монеаи ҷиддӣ аст. Баъзе масъалаҳои хеле ҷиддии форматкунӣ вуҷуд доранд, ки шояд натиҷаи табдил аз формати .doc ё .docx ба .PDF бошад ва ин хатогиҳо қисматҳои ин матнро корношоям мекунанд. Ин дар боби 14, Кинетикаи химиявӣ ба таври ҳайратангез аён аст, ки дар он бисёр операторҳо (e, superscript ва ғайра) бо квадратҳои холӣ иваз карда шудаанд. Омӯзгор бояд барои ислоҳи ин хатогиҳои формат вақти зиёд сарф кунад ва барои таълим вақти хеле кам боқӣ мемонад! Инчунин мушкилоти форматкунӣ бо зерхаттҳо дар формулаҳои кимиёвӣ вуҷуд доранд, ки ҳамчун зерхатраҳо намоиш дода намешаванд, боз як масъалаи форматкунӣ мебошад.</p>

Рейтинги дақиқии мундариҷа: 4

<p> Агар касе ба ҳамаи хатогиҳои форматкунии дар матн мавҷудбуда сарфи назар карда шавад (ниг. ба саволи №1 дар боло) он гоҳ дақиқӣ бештар аз кофӣ хоҳад буд. Ҳангоми таъини холҳои дақиқ ман масъалаҳои форматкуниро дар бар намегирам.</p>

Рейтинги аҳамият/дарозиум: 4

<p> Намунаҳои матн ва он&#39s ҳам мувофиқ ва ҳам беохиранд Раванди классикии Хабер-Бош барои истеҳсоли аммиак танҳо як мисол аст. Ман мисоли мавҷудияти сатҳи баланди иридиумро дар таҳшинҳои 66 миллионсола қадр кардам, ки далели асосии таъсири астероидҳост, ки шояд боиси нобудшавии динозаврҳо шуда бошад, чизеро, ки донишҷӯёни ман метавонанд қадр кунанд ва ба онҳо алоқаманд бошанд. Муаллиф дар мубохисаи хеле хуби усули илмй мисоли иридиуми дар боло зикршударо истифода мебарад. Агар устод ва муаллимоне, ки ин матнро қабул мекунанд, ба ҳуҷҷати аслӣ (.doc ё .docx) дастрасӣ дошта бошанд, он гоҳ навсозиҳои зарурӣ осон ва содда таҳрир кардани матн ҳамчун файли .pdf бори гарон хоҳад буд.</p>

<p> Матн беш аз возеҳияти кофӣ дорад, аммо баъзе аз ҳисобҳои намунавӣ аз форматкунии иловагӣ манфиат мегиранд. Мисол муайян кардани формулаи эмпирикии пенициллин аст, ки ҳисобҳо ба таври хаттӣ навишта мешаванд, ки донишҷӯи миёнаи химияи умумӣ ҳангоми пайравӣ кардани мисоли додашуда гум мешавад. Инчунин мушкилоти форматкунӣ, ки дар саволи №1 баррасӣ шудаанд, муодилаҳои зиёдеро чунон печида мегардонанд, ки барои донишҷӯи фанни химияи умумӣ нофаҳмоанд</p>

<p> Матн аз ҷиҳати истилоҳот ва муаррифӣ комилан мувофиқ аст.</p>

<p> Набудани ҷадвали мундариҷа имкон намедиҳад, ки матн ба осонӣ аз нав ташкил ва/ё мувофиқ карда шавад. // Ҳама мавзӯъҳои маъмулии курси умумии химияи яксола мавҷуданд ва бо ҷадвали мувофиқи мундариҷа матн хеле модулӣ хоҳад буд.</p>

Ташкил / Сохтор / Рейтинги ҷараён: 4

<p> Чунин ба назар мерасад, ки ҳар як омӯзгор барои курси умумии химия, ки онҳо таълим медиҳанд, созмон/сохтор/маҷрои бартарии худро доранд! Ин матн тавре навишта шудааст, ки мутобиқ кардани мундариҷа ба афзалиятҳои мушаххаси устодон хеле осон хоҳад буд.</p>

<p> Оддӣ карда гӯем, дар форматкунии муодила (ҳам аз ҷиҳати кимиёвӣ ва ҳам математикӣ) хатогиҳои зиёд доранд, то ин матн қобили истифода бошад.</p>

Рейтинги хатогиҳои грамматикӣ: 4

<p> Ман ягон мушкилоти грамматикиро намебинам.</p>

Рейтинги аҳамияти фарҳангӣ: 5

<p> Татбиқ нест. Ин матни химия аст.</p>

<p> Таълим дар коллеҷи ҷамоатӣ бо аҳолии назарраси ақаллиятҳо ва шумораи зиёди донишҷӯёни насли аввал, ки дар он хароҷоти таҳсил дар коллеҷ як масъалаи муҳим аст, ман ҳамеша роҳҳои паст кардани арзиши таҳсили онҳоро бе паст кардани сифат меҷӯям. Ман аз фаҳмидани Китобхонаи кушоди дарсӣ ҳамчун як усули кам кардани арзиши китобҳои дарсӣ ба ҳаяҷон омадам ва азбаски қисми асосии сарбории таълимии ман таълими пайдарпаии умумии химияи сол аст, ман умедвор будам, ки ин матн ниёзҳои маро қонеъ мекунад. Мутаассифона, аз сабаби мушкилоти ҷиддии форматкунӣ ман ин матнро истифода бурда наметавонам. Агар дар оянда мушкилоте, ки дар ин барраси ман таъкид карда будам, ислоҳ шаванд, ман омодаам ин матнро қабул кунам ва ман мехостам вокуниши донишҷӯёни худро ба маҳсулоти Китобхонаи дарсӣ кушода бишнавам.</p>


Маҷаллаҳо

Муаллифонро бо тартибе, ки дар матни аслӣ пайдо мешаванд, номбар кунед ва пас аз он нуқта гузошта шавад. Давраҳо инчунин сарлавҳаи мақола ва маҷалла ва ҳаҷми маълумот ё нашрро пайгирӣ мекунанд. Санаро аз ҳаҷм ва нашр бо нуқта-вергул ҷудо кунед. Ҷойгиршавӣ (одатан диапазони саҳифаи мақола) дар пеш бо ду нуқта гузошта мешавад.

Муаллиф(ҳо). Сарлавҳаи мақола. Сарлавҳаи рӯзнома. Ҳаҷми (масъала): ҷойгиршавӣ.

Унвонҳои маҷаллаҳо одатан мувофиқи Рӯйхати ихтисороти калимаҳои унвонӣ, ки аз ҷониби Маркази байналмилалии ISSN нигоҳ дошта мешаванд, ихтисор карда мешаванд. Ба Замимаи 29.1 нигаред Услуб ва формати илмӣ Барои маълумоти бештар.

Барои мақолаҳое, ки зиёда аз 1 муаллиф доранд, номҳо бо вергул ҷудо карда мешаванд.

Smart N, Fang ZY, Marwick TH. Дастури амалӣ барои омӯзиши машқ барои беморони норасоии қалб. Корти J ноком. 20039(1):49&ndash58.

Барои мақолаҳое, ки зиёда аз 10 муаллиф доранд, 10-и аввалро номбар кунед ва пас аз он &ldquoet al.&rdquo

Pizzi C, Caraglia M, Cianciulli M, Fabbrocini A, Libroia A, Matano E, Contegiacomo A, Del Prete S, Abbruzzese A, Martignetti A, et al. Рекомбинати вояи ками IL-2 тағйироти психологиро ба вуҷуд меорад: мониторинг аз ҷониби Инвентаризатсияи шахсияти бисёрфазивии Миннесота (MMPI). Res. зидди саратон. 200222 (2А): 727&ndash732.

Ҳаҷм бидуни мушкилот ё зербахшҳои дигар

Ласковски Д.А. Хусусиятҳои физикӣ ва химиявии пиретроидҳо. Rev Environ Contam Toxicol. 2002174:49&ndash170.

Ҳаҷм бо нашр ва замима

Gardos G, Cole JO, Haskell D, Marby D, Paine SS, Moore P. Таърихи табиии дискинезияи деривӣ. J Clin Pharmacol. 19888 (4 Suppl): 31S&ndash37S

Ҳаҷм бо илова, аммо ҳеҷ мушкиле нест

Heemskerk J, Tobin AJ, Ravina B. Аз кимиёвӣ ба маводи мухаддир: скрининги маводи мухаддир нейродегенератсия ва этикаи озмоишҳои клиникӣ. Nat Neurosci. 20025 Таъминот: 1027&ndash1029.

Рамстром О, Буняпаибонсри Т, Лохман С, Лен ЧМ. Биологияи химиявии китобхонаҳои комбинатсияи динамикӣ. Biochim Biophys Acta. 20021572(2&ndash3):178&ndash186.

Sabatier R. Reorienting хизматрасонии тандурустӣ ва иҷтимоӣ. AIDS STD Health Promot Exch. 1995(4):1&ндаш3.


Кори курсӣ: Формати иқтибосҳо ва истинодҳо

Ҳангоми навиштани корҳои курсии худ, барои шумо ҳуҷҷатгузорӣ кардан муҳим хоҳад буд, ки маълумоти дар гузориши худ зикршударо аз куҷо гирифтаед. Бисёре аз истинодҳое, ки шумо истифода мебаред, аз манбаъҳои нашршуда гирифта мешаванд. Баъзеҳо метавонанд аз манбаъҳои электронӣ, аз қабили шабакаи ҷаҳонии интернет, махзани маълумотҳои Melvyl ва Harvest, ки тавассути китобхонаи UC Davis дастрасанд, истинодҳои CD ва монанди инҳо, ва баъзеҳо метавонанд аз мусоҳибаҳо пайдо шаванд. Як ҷузъи муҳими навиштани шумо истифодаи самараноки маводи истинод хоҳад буд. Ин маҳорат ба шумо дар навиштани варақаҳои ҳама намудҳо хизмат мекунад, на танҳо онҳое, ки барои дарсҳо заруранд.

Барои ин синф, мо услуби ҳуҷҷатгузории Ассотсиатсияи равоншиносии Амрикоро (APA, 2001) истифода хоҳем кард, ки бо ҳарфҳои курсив иваз карда шуда, барои зерхат иваз карда шудаанд. Ин формат ба формати Ассотсиатсияи Забони муосир хеле монанд аст ва инҳо услубҳои маъмултарин барои нашр дар илмҳои иҷтимоӣ ва табиӣ мебошанд. Шакли умумии иқтибосҳо дар матни матн ин дохил кардани муаллиф ва сана дар қавс (тавре ки дар боло) ва ихтиёрӣ рақами саҳифаҳо пас аз сана аст. Агар номи муаллиф танҳо дар матн зикр шуда бошад, дар иқтибос такрори он шарт нест. Қоидаҳо бо мисолҳо дар фасли 3 муфассалтар тавсиф карда шудаанд.

2. Роҳнамои асосӣ

Мақсади кори курсӣ дар ECS 15 аз он иборат аст, ки шумо омӯхтани чӣ гуна тадқиқоти муассир дар ин мавзӯъ ва сипас онро ба таври возеҳ нависед ва нишон диҳед, ки маълумотро аз куҷо гирифтаед.

Ҳуҷҷати тадқиқотӣ ҷустуҷӯи иттилооти марбут ба мавзӯи додашуда, ба тартиб даровардани он ва пешниҳоди муассир дар шакли хаттиро талаб мекунад. Ҳисоботи таҳқиқоти шифоҳӣ низ муфид аст, аммо ин курс онҳоро дар бар намегирад.

Дар бахшҳои минбаъда мо роҳеро пешниҳод хоҳем кард, ки мо мехоҳем аз шумо истинодҳои худро дар кори курсии ин курс иқтибос кунед. Формати зарурӣ ба таҷрибаҳои қабулшуда, ки дар Ли ва Кран (1993) оварда шудаанд, мувофиқат мекунад, ки ин истинод дар айни замон беҳтарин мақоми истинод ба манбаъҳои электронӣ ҳисобида мешавад. Ин китоб дар навбати худ ба формати асосии Ассотсиатсияи равоншиносии Амрико (APA, 2001) пайравӣ мекунад, ки формати хуб аст (гарчанде ки ба ҳеҷ ваҷҳ ягона дар нашрияҳои техникӣ қобили қабул нест). Шояд аз шумо талаб карда шавад, ки форматҳои каме гуногунро барои дигар мақолаҳо истифода баред, масалан, ҳуҷҷатҳое, ки барои нашр ба маҷаллаҳои ҳакамӣ пешниҳод карда мешаванд, ки ҳар яки онҳо одатан услубҳои худро доранд. Омӯзиши чӣ гуна риоя кардани як чунин маҷмӯи қоидаҳо як машқи арзанда аст. Аз ин рӯ, интизор меравад, ки шумо формати дар поён овардашударо истифода баред.

3. Иқтибос дар матн ба истинодҳо

Ҳангоми истинод ба истинод аз рӯйхати истинодҳои худ, лутфан конвенсияҳои зеринро истифода баред. Дар қавс фамилия муаллиф(ҳо), сол ва ихтиёрӣ рақами саҳифа(ҳо)-ро бо вергул ҷудо кунед.

Барои як муаллиф, насаб ва соли муаллифро бо вергул ҷудо кунед. Масалан: (Уолтерс, 1994) ё (Остин, 1996).

Барои аз ду то панҷ муаллиф, насабҳои онҳоро бо вергул ҷудо карда, бо амперсанди "&" пеш аз насаби рӯйхат ва баъд аз соли бо вергул ҷудошуда истифода баред. Масалан: (Li & Crane, 1993) (Charniak, Riesbeck, McDermott & Meehan, 1994).

Барои зиёда аз панҷ муаллиф, насаби муаллифи аввал ва "et al."-ро истифода баред. Масалан: (Walters, et al., 1992).

Барои сана, солро истифода баред. Агар ду истинод аз ҷониби як муаллиф(ҳо) барои як сол мавҷуд бошад, пас аз сол ҳарфҳоро истифода баред: (Walters, 1993b).

Агар барои иқтибос рақамҳои мушаххаси саҳифа мавҷуд бошанд, онҳоро пас аз сол илова кунед (Уолтерс, 1994, саҳ. 31-49).

Агар шумо номи муаллиф(ҳо)-ро дар матни ҷумлаи коғаз дохил кунед, шумо метавонед номи онҳоро аз қавс ба таври зерин гузоред: "Austin (1996) истинодҳои арзишмандро ба . " ё "Намунаҳои аз ҷониби Ли ва Крейн (1993) дар суроғаҳои веб овардашуда. ".

Дар ин синф эзоҳҳоро барои иқтибос истифода набаред. Шумо метавонед онҳоро барои матни фаҳмондадиҳӣ истифода баред, аммо на барои истинод. Иқтибосро бигзоред, ки истинодро дар бахши "Иқтибосҳо" осон кунад. Ҳама истинодҳо дар ин бахш бояд ба қадри кофӣ мукаммал бошанд, то хонандагон барои худ нусхабардорӣ кунанд.

4. Рӯйхати истинодҳои шумо

Рӯйхати истинодҳоро, ки барои ҳар як банди дар коғаз оварда шудааст, дар қисмате бо номи "References" эҷод кунед. Ин бахш дар охири коғази шумо меравад. Истинодҳо бояд аз рӯи фамилияи муаллиф ё (агар ягон муаллиф дар рӯйхат набошанд) ташкилот ё унвони алифбо тартиб дода шаванд. Агар шумо зиёда аз як мақолаи як муаллифи аввалро иқтибос кунед, онҳоро аз рӯи соли нашр, соли аввали аввал ҷудо кунед. Барои иқтибосҳо эзоҳҳоро истифода набаред.

Вурудҳоро дар рӯйхати истинодҳои худ як фосила гузоред. Аз ҳошияи чапи сатри аввали ҳар як варақаи библиография оғоз кунед. Ҳар як сатри иловагии ҳар як воридот бояд миқдори мувофиқ ворид карда шавад. Сабтҳоро бо хати холӣ ҷудо кунед. Истинодҳоро рақам накунед. Ин маънои онро дорад, ки шумо бояд ҳангоми ворид кардани истинодҳои нав ҳамаи истинодҳоро дубора рақамгузорӣ кунед.

4.1. Муаллиф, сана ва унвон

Формати умумии муаллиф, унвон ва сана дар рӯйхати истинодҳои шумо чунин аст:

Дар зер ин соҳаҳо шарҳ дода мешаванд.

Муаллиф

Насаби муаллифи аввал, пас аз он ҳарфҳои аввал. Агар ду муаллиф бошанд, номи онҳоро бо аломати "and" ҷудо кунед. Барои се ё зиёда муаллиф, ҳамаро ба ҷуз номи охирини муаллиф бо вергул ҷудо кунед ва пеш аз номи охирини муаллиф дар рӯйхат "and" -ро истифода баред. Агар аз ҷониби агентие нашр шуда бошад, ки муаллиф надорад, номи агентиро номбар кунед. Бо давра ба охир расонед. Барои намуна:

Уолтерс, Р.Ф., Бҳарат, С.Р. ва Остин, А.А.

Чарниак, Э., Рисбек, К., МакДермотт, Д. ва Михан, Ҷ.

Санаро дар қавс гузоред. Барои ашё санаи кофӣ мушаххасро истифода баред. Масалан, соли нашри китоб, сол ва моҳи нашри маҷалла ё маҷаллаи моҳона ва сол, моҳ ва рӯз барои рӯзнома ё рӯзномаро бидонед. Бо давра ба охир расонед. Барои намуна:

Унвон

Агар сарлавҳа мақола бошад, ҳуруфи муқаррариро истифода баред, агар он унвони китоб бошад, онро курсив кунед. Танҳо ҳарфи аввали калимаи аввал ва исмҳои хосро калон кунед. Агар субтитр мавҷуд бошад, он низ бояд бо ҳарфи калон оғоз шавад. Бо давра ба охир расонед. Масалан, унвони мақола чунин хоҳад буд:

ва унвони китоб чунин хоҳад буд:

4.2. Маҷаллаҳо, маҷаллаҳо ва рӯзномаҳо

Инҳо ба истинод ба ном ва маълумоти мушаххас барои маҷаллаҳо, маҷаллаҳо, рӯзномаҳо ва умуман нашрияҳои даврӣ дахл доранд.

Унвон

Ҳангоми истинод ба номи маҷалла, маҷалла ё рӯзнома, номро бо ҳарфҳои курсив нависед, ба истиснои мақолаҳо, пешвандҳо ва пайвандакҳо ҳама калимаҳои калонҳарф.

Ҳаҷм, рақам ва рақамҳои саҳифа

Рақами ҳаҷмро бо курсив, пас аз он рақами нашрро дар қавс (агар рақами нашр мавҷуд бошад) ва рақами саҳифа(ҳо)-ро диҳед. Барои маҷаллаҳо, пеш аз рақамҳои саҳифа бо "p." (агар мақола дар як саҳифа бошад) ё "pp" (агар мақола дар якчанд саҳифа бошад) гузоред. Барои намуна:

Муоширати ACM, 27 (2), 141-195.

Журнали тадцицоти реклама, 32, 47-55.

Ношир ва макон

Шаҳр ва иёлотро (агар дар Иёлоти Муттаҳида бошад), пас аз он ду нуқта ва номи ноширро, пас аз он нуктаро диҳед. Барои намуна:

Englewood Cliffs NJ: Prentice-Hall.

4.3. Мусоҳибаҳо

Агар шумо хоҳед, ки ягон мусоҳибаи шахсиро дохил кунед, ба онҳо бо номи шахс, унвони касбӣ ва корфармо, сана, вақт ва ҷои мусоҳиба ишора кунед. Барои намуна:

4.4. Иқтибосҳо дар шакли электронӣ пайдо шудаанд

Бисёре аз маводҳои захиравӣ тавассути Melvyl ва Harvest дастрасанд, ки нуқтаҳои дастрасии электронии китобхонаи UC Davis мебошанд. Бештар дар CDROM ё дар Интернет ҳастанд. Инҳо метавонанд ҳамчун истинодҳои мувофиқ барои гузоришҳои тадқиқотӣ ва корҳои курсӣ хизмат кунанд. Аммо муҳим аст, ки эътироф кардани манбаъҳои ин ҳуҷҷатҳо, гарчанде ки шумо ҳеҷ гоҳ "hard" (версияҳои чопӣ)-и файл(ҳо)-ро, ки мехоҳед истинод кунед, надидаед. Ин бахш шарҳ медиҳад, ки чӣ гуна шумо бояд истинодҳоеро, ки аз анбори электронӣ гирифтаед, истинод кунед.

Шакли асосии маълумотномаи шумо ба истинодҳои чопшуда монанд хоҳад буд, аммо ба шумо лозим меояд, ки маълумоти муҳими иловагиро илова кунед: навъи воситаи истифодашаванда ва мавҷудияти мавод.

Умуман, агар шумо хоҳед, ки ба файли электронӣ истинод кунед, шумо бояд истилоҳи "[Онлайн]" ё истилоҳи "[CDROM]" (дар қавсҳои мураббаъ дохил карда шудаанд) пеш аз давраи хотимавӣ, ки унвони кори зикршударо қатъ мекунад, дохил кунед. Агар шумо як қисми асари калонтарро иқтибос оварда бошед, шумо бояд сарлавҳа ва пас аз вергул, калимаи "In" ва пас аз он кори калонтарро гузоред ва мувофиқи мувофиқ "[Онлайн]" ё "[CDROM]" илова кунед. як давра.

Истинод дар бораи мавҷудияти ҳуҷҷати электронӣ бояд ба хонанда маълумоти кофӣ диҳад, то бидонад, ки файлро дар куҷо ҷойгир кардан лозим аст ва дар ҳолати зарурӣ қисми мушаххаси файли истинодшуда. Ҳуҷҷатҳои электронӣ метавонанд аз якчанд намуди маконҳо дастрас шаванд:

ftp: сервери ftp, макон (роҳ) ва номи файлро муайян кунед

Интернет (масалан, шабакаи умумиҷаҳонӣ): ҷойгиршавӣ ва номи файлро диҳед, ки URL кифоя аст

Рӯйхати почтаи электронӣ, гурӯҳҳои хабарӣ: муайян кардани сервер, усули дастрасӣ ва номи файл аз почтаи шахсии худ истинод накунед

Дар ҳар як ҳолат, шумо бояд маълумоти кофӣ пешниҳод кунед, то хонанда бидонад, ки чӣ тавр ба иттилоот ба таври электронӣ дастрасӣ пайдо кунад. Умуман, додани сайт (номи сервери услуби интернет), ки маълумот дар он ҷойгир аст, номи файл ва роҳи пурраи (рӯйхати директорияҳо), ки чӣ тавр ба он расидан мумкин аст, кифоя аст. Масалан:

[Онлайн]. Дастрас: почтаи электронӣ: [email protected] Паём: POETICS ИМРУЗ гиред.

[Онлайн] Дастрас: FTP: ftp.bio.indiana.edu, Ҷойгиршавӣ: /usenet/bionet/neuroscience, Файл: 9512.newsm.

[CDROM]. Дастрас: Файли UMI: Маҷаллаҳои даврии Ondisk 91-11501.

5. Намунаҳои истинодҳои мукаммал

Ҳамаи мисолҳои дар боло овардашуда метавонанд бо истинод ба якчанд истинодҳо дар шакле, ки мо мехоҳем, ки шумо истифода баред, ҷамъбаст карда шавад. Инҳоянд чанд мисоле, ки дар матн ҳамчун (Crosley, 1988), (Essinger, 1991, 28 май, саҳ. 97-99), (Armstrong & Keevil, 1991, саҳ. 103) ва ғайра оварда мешаванд.

5.1. Китоби чопшуда

Кросли, LM (1988). Дастури меъморон барои тарҳрезии компютерӣ. Торонто: Ҷон Уайли ва Писарон.

5.2. Мақолаи маҷалла

Эссингер, Ҷ. (1991, 28 май). Танҳо як воситаи дигари тиҷорати шумо. Бухгалтерия 108, сах. 91-125.

5.3. Мақолаи рӯзнома

Армстронг, П. ва Кивил, С. (1991). Томографияи резонанси магнитӣ-2: Истифодаи клиникӣ. Маҷаллаи тиббии Бритониё 303 (2), 105-109.

5.4. Мусоҳиба

Компютер, Кристофер С. (1996, 10 январ) Профессор, кафедраи илмҳои компютерӣ, Донишгоҳи Калифорния - Дэвис, соати 15:00, Дэвис, Калифорния.

5.5. Суроғаи шабакаи ҷаҳонии интернет

Остин, A. (1996) Рӯйхати шарҳи навиштаҷоти техникии веби умумиҷаҳонӣ ва захираҳои композитсия бо ёрии компютер [онлайн]. Дастрас: http://wwwcsif.cs.ucdavis.edu/~austina/cai.html.

Берк, Ҷ. (1992, январ/феврал). Тадқиқот ва усулҳои кӯдакон: Муҳаққиқони ВАО чӣ кор мекунанд, Маҷаллаи Тадқиқоти Реклама, 32, RC2-RC3. [CDROM]. Дастрас: UMI File: Business Periodicals Ondisk Item: 92-11501.


Энсиклопедияи вирусология

Энсиклопедияи вирусология, нашри сеюм муваффақияти худро ҳамчун бузургтарин манбаи истинод ба тадқиқоти ҷорӣ дар вирусология идома медиҳад. Ин асари ситоишшуда дар истифодаи мақолаҳои мухтасари “мини-баррасӣ” беназир аст, ки мавзӯъҳои биологӣ, молекулавӣ ва тиббиро дар бораи вирусҳо дар ҳайвонот, наботот, бактерияҳо ва ҳашарот фаро мегирад. Ҳоло дар панҷ ҷилд, ин нашри нав ба таври васеъ таҳрир ва навсозӣ шудааст, то 50% афзоиши вирусҳои муайяншуда ва қабулшударо аз соли 2000 инъикос намояд. Бо зиёда аз 25% бобҳои нав ва зиёда аз 1000 тасвирҳо, ин нашр таҳаввулоти навро дар тадқиқоти вирусологӣ тавассути дохил кардани маълумот дар бораи бемориҳои нави пайдошаванда, ба монанди зукоми парранда, SARS ва Нили Ғарбӣ ва қобилияти истифода шудани баъзе вирусҳо ҳамчун агентҳои биотерроризм. Ин нашри сеюм аз ҷониби вирусологҳои пешқадам Махи ва ван Регенмортел таҳрир карда шудааст, ки рақами як манбаи ҳамаҷонибаи иттилоот барои муҳаққиқони вирусология, донишҷӯён ва шӯъбаҳои маълумотномаҳои китобхонаҳои академӣ, тиббӣ ва корпоративӣ боқӣ мемонад.

Энсиклопедияи вирусология, нашри сеюм муваффақияти худро ҳамчун бузургтарин манбаи истинод ба тадқиқоти ҷорӣ дар вирусология идома медиҳад. Ин асари ситоишшуда дар истифодаи мақолаҳои мухтасари “мини-баррасӣ” беназир аст, ки мавзӯъҳои биологӣ, молекулавӣ ва тиббиро дар бораи вирусҳо дар ҳайвонот, наботот, бактерияҳо ва ҳашарот фаро мегирад. Ҳоло дар панҷ ҷилд, ин нашри нав ба таври васеъ таҷдид ва таҷдид карда шудааст, то 50% афзоиши вирусҳои муайяншуда ва қабулшударо аз соли 2000 инъикос намояд. Бо зиёда аз 25% бобҳои нав ва зиёда аз 1000 тасвир, ин нашр таҳаввулоти навро дар тадқиқоти вирусологӣ тавассути дохил кардани маълумот дар бораи бемориҳои нави пайдошаванда, ба монанди зукоми парранда, SARS ва Нили Ғарбӣ ва қобилияти истифода шудани баъзе вирусҳо ҳамчун агентҳои биотерроризм. Ин нашри сеюм аз ҷониби вирусологҳои пешқадам Махи ва ван Регенмортел таҳрир карда шудааст, ки рақами як манбаи ҳамаҷонибаи иттилоот барои муҳаққиқони вирусология, донишҷӯён ва шӯъбаҳои маълумотномаҳои китобхонаҳои академӣ, тиббӣ ва корпоративӣ боқӣ мемонад.


Иқтибосҳо

Онҳо ба мисли Дарвин ё Кюри машҳур нестанд, аммо ин қаҳрамонон ҳаёти моро тавассути дастовардҳои бунёдкорона беҳтар карданд.

Алберт Эйнштейн: Ҳаёти як физики олиҷаноб

Ин қадар бештар аз мӯи хандовар.

Дастур барои шурӯъкунандагон барои саёҳати вақт

Аз ҷониби Эндрю Мэй, маҷаллаи он чӣ гуна кор мекунад

Айнан фаҳмед, ки назарияи нисбияти Эйнштейн чӣ гуна кор мекунад ва бифаҳмед, ки чӣ гуна дар илм чизе вуҷуд надорад, ки саёҳати вақтро имконнопазир гӯяд.

Роберт Ҳук: олими англис, ки ҳуҷайраро кашф кардааст

Аз ҷониби Ailsa Harvey, маҷаллаи он чӣ гуна кор мекунад

Роберт Ҳук полимати англис буд, ки блокҳои сохтмонии тамоми ҳаётро кашф кард.

Хатти санаи байналмилалӣ, фаҳмонд

Хатти санаи байналмилалӣ консепсияест, ки аксар вақт бо нофаҳмиҳо ва нофаҳмиҳо пур мешавад. Аммо он дар ҳаёти мо нақши муҳим ва дар ҳисоб кардани вақт нақши марказӣ мебозад.

Хирсҳои сиёҳ: Хирс маъмултарин дар Амрикои Шимолӣ

Хирсҳои сиёҳи амрикоӣ хурдтарин ва маъмултарин хирс дар Амрикои Шимолӣ мебошанд. Онҳо хеле мутобиқанд, бо парҳезе, ки асал ва мурғро дар бар мегирад.

Ацетаминофен: истфода, таъсири тараф ва аз меъёр зиёд

Ацетаминофен ба ду гурӯҳи доруҳо тааллуқ дорад: анальгетикҳо (рафкунакҳои дард) ва зиддипиретикҳо (пасткунандаи табларза).

Juneteenth чист?

Иди амрикоии Juneteenth 19 июн ҷашн гирифта мешавад. Он ҳамчунин ҳамчун Рӯзи озодшавӣ ва Рӯзи истиқлолияти сиёҳ маълум аст.

Доштани кӯдак: Марҳилаҳои ҳомиладорӣ аз рӯи триместр

Ҳомиладорӣ тақрибан 40 ҳафта давом мекунад ва ба се марҳила ё семоҳаҳо тақсим мешавад, ки ҳар яки онҳо аломатҳо ва тағирот дар бадани модар ва рушди ҳомила доранд.

Морҳои Cottonmouth: Далелҳо дар бораи мокасинҳои обӣ

Аз ҷониби Ҷесси Сзалай, Патрик Пестер

Морҳои заҳрнок дар Амрикои Шимолӣ, ки ҳангоми таҳдид даҳони сафед доранд, даҳони пахта ё мокасинҳои обӣ мебошанд.

Роҳи Каҳкашон чист?

Тамоми илми Роҳи Каҳкашон, аз ҷумла андозаи галактикаи хонагии моро, ки онро кӣ кашф кардааст ва чӣ гуна он дар ҷараёни бархӯрд бо галактикаи дигар аст, бифаҳмед.

Тағйирёбии рӯҳия ва мағзи модар: Мушкилоти эмотсионалии ҳомиладорӣ

Некӯаҳволии эмотсионалии зан ва ҷаҳонбинии равонии ӯ дар ҳомиладорӣ нақши муҳим доранд.

Лемурҳо: Гурӯҳи гуногуни приматҳои дар зери хатар қарордошта

Лемурҳо як гурӯҳи гуногуни приматҳоро дар бар мегиранд, аз лемурҳои ҳалқаи думдор ба офтобпараст то эй-айе, ки шабҳангом.

Газҳои гулхонаӣ: сабабҳо, манбаъҳо ва таъсири муҳити зист

Аз ҷониби Тиффани, Марк Лалланилла

Газҳои гармхонаӣ газҳои атмосфера мебошанд, ки радиатсияи инфрасурхро ҷабб мекунанд ва гармиро дар атмосфера нигоҳ медоранд. Афзоиши партовҳои ин газҳо боиси тағирёбии иқлим ва гармшавии глобалӣ мегардад.

Шаҳрҳои ғарқшуда: Ҷойҳои воқеии 'Атлантида'-ро, ки дар зери мавҷҳо пинҳон шудаанд, кашф кунед

Никол Робинсон, маҷаллаи "Чӣ тавр кор мекунад"

Шаҳрҳои зериобшударо биомӯзед, то бифаҳмед, ки чаро онҳо аз санҷиши вақт наҷот наёфтанд.


Тафовут дар байни библиография ва истинодҳо

Библиография ва истинодҳо

Одамон аксар вақт фикр намекунанд, ки байни библиография ва истинодҳо фарқият вуҷуд дорад. Онҳо аксар вақт хато мекунанд, ки ҳардуро якхела медонанд. Аммо, онҳо гуногунанд ва бо ҳар як эссе ё мақола ё китоб дар заминаҳои гуногун истифода мешаванд.

Библиография номбар кардани ҳамаи маводҳое мебошад, ки ҳангоми навиштани иншо ё китоб машварат карда шудаанд. Аз тарафи дигар, истинодҳо онҳое мебошанд, ки дар мақола ё китоби шумо истинод карда шудаанд.

Шумо шояд барои навиштани чизе ба бисёр китобҳо, эссеҳо ва вебсайтҳо муроҷиат кардаед. Гарчанде ки шумо ҳангоми омода кардани навиштан ба инҳо муроҷиат карда бошед ҳам, мундариҷаи онҳо ба матни воқеӣ дохил карда нашуда буд. Ин аст он чизе ки ба библиография дахл дорад. Иқтибосҳо онҳое мебошанд, ки бевосита ба матни воқеии шумо дохил карда шудаанд.

Дар ҳоле ки истинодҳо мустақиман дар матн оварда шудаанд, библиография бевосита дар матн оварда намешавад. Гарчанде ки истинодҳо метавонанд барои дастгирии изҳорот ё далели шумо истифода шаванд, библиография чунин нақшҳоро надорад. Ҳамин тариқ, истинодҳо барои таъсиси чизе ба таври мӯътабартар истифода мешаванд. Хонандагон метавонанд ба истинодҳои шумо муроҷиат кунанд ва дурустии изҳороти шуморо арзёбӣ кунанд. Дар ҳамин ҳол, библиография далели шуморо дастгирӣ намекунад, аммо шумо ба онҳо танҳо ба таври шахсӣ муроҷиат мекунед.

Библиография тамоми маводи тадқиқотиро дар бар мегирад, аз ҷумла китобҳо, маҷаллаҳо, нашрияҳои даврӣ, вебсайтҳо ва мақолаҳои илмие, ки шумо истинод кардаед. Иқтибосҳо дорои манбаи маводи монанди иқтибосҳо ё матнҳо мебошанд, ки воқеан ҳангоми навиштани эссе ё китоб истифода шудаанд.

Ҳам библиография ва ҳам истинодҳо дар охири ҳуҷҷат пайдо мешаванд. Аммо библиография пас аз рӯйхати истинодҳо меояд. Библиография метавонад ҳамаи онҳоеро дар бар гирад, ки дар рӯйхати истинодҳо мавҷуданд, аммо он метавонад корҳои иловагиро низ дар бар гирад.

Ҳам библиография ва ҳам истинодҳо аз рӯи алифбо тартиб дода шудаанд. Аммо рӯйхати истинодҳоро низ метавон бо услуби ададӣ тартиб дод, ки маънои ҷойгиркунии истинодҳоро мувофиқи рақамҳои матн дорад.

Ҳангоми навиштани библиография шумо бояд насаб ва ному насаби муаллифон, соли нашр, номи китоб, ҷои нашр ва номи ноширонро нишон диҳед. Хуб, саҳифаи истинодро метавон ҳамчун эзоҳ номид, ки дар он шумо танҳо китоб ё вебсайтро нависед ва соли нашр ё санаи ба вебсайт нигаристашуда.

Хулоса
1.Библиография номбар кардани ҳамаи маводҳое мебошад, ки ҳангоми навиштани иншо ё китоб маслиҳат гирифтаанд. Аз тарафи дигар, истинодҳо онҳое мебошанд, ки дар мақола ё китоби шумо истинод карда шудаанд.
2.Библиография бевосита ба матн дохил карда нашудааст. Иқтибосҳо онҳое мебошанд, ки бевосита ба матни воқеии шумо дохил карда шудаанд.
3.Ҳам библиография ва ҳам истинодҳо аз рӯи алифбо ҷойгир шудаанд. Аммо рӯйхати истинодҳоро низ метавон бо услуби рақамӣ тартиб дод,


Қабатҳои пӯст

Гарчанде ки шумо одатан пӯстро ҳамчун узв фикр намекунед, он дар асл аз бофтаҳо иборат аст, ки якҷоя ҳамчун сохтори ягона барои иҷрои вазифаҳои беназир ва муҳим кор мекунанд. Пӯст ва сохторҳои иловагии онро ташкил медиҳанд системаи мағзи сар, ки баданро бо муҳофизати умумӣ таъмин мекунад. Пӯст аз қабатҳои сершумори ҳуҷайраҳо ва бофтаҳо иборат аст, ки онҳоро бо бофтаи пайвасткунанда дар сохторҳои зеризаминӣ нигоҳ медоранд (расми 1). Қабати амиқтари пӯст хуб рагҳо дорад (рагҳои сершумори хун дорад). Он инчунин дорои нахҳои сершумори асабҳои ҳассос, вегетативӣ ва симпатикӣ мебошад, ки алоқаро ба майна ва аз майна таъмин мекунад.

Расми 1. Пӯст аз ду қабати асосӣ иборат аст: эпидермис, ки аз ҳуҷайраҳои эпителиалӣ зич печонида шудааст ва дерма, ки аз бофтаи пайвастаи зиччи номунтазам иборат аст, ки дар он рагҳои хун, фолликулаҳои мӯй, ғадудҳои арақ ва дигар сохторҳо ҷойгиранд. Дар зери пӯст қабати гиподерма ҷойгир аст, ки асосан аз бофтаҳои пайвасткунандаи фуҷур ва чарбу иборат аст.


Мавод ва усул

Материалхо

Санҷишҳои TMRM ва JC-1 аз Invitrogen Life Technologies (Карлсбад, CA, ИМА ва Дун Лаогэйр, Ирландия) буданд. Реагенти Blotting Amersham™ ECL™ Prime Western Western аз GE Healthcare Life Sciences (Waukesha, WI, ИМА) буд, гелҳои акриламиди қаблан сохташуда, буферҳои равон ва интиқол аз GeneScript (Piscataway, NJ, ИМА), буфери RIPA, BCA™ Protein Assay буд. маҷмӯа ва нардбони сафедаи пешакӣ аз Thermo Fisher Scientific (Рокфорд, IL, ИМА) буданд. CellTiter-Glo® ATP Assay аз Promega (Мэдисон, WI, ИМА) буд. Таблетҳои коктейлии PhosphoStop Phosphatase Inhibitor ва Inhibitor Protease Inhibitor Cocktail аз Roche (Дублин, Ирландия) буданд. Василаи Dulbecco's Modified Eagle's (DMEM), василаи Институти ёдбуди Росвелл Парк (RPMI), циклогексид ва ҳама реактивҳои дигар аз Сигма-Олдрих (Сент-Луис, MO, ИМА) буданд. Антителоҳои ибтидоӣ ва дуюмдараҷа дар файли иловагии 4 номбар шудаанд. Зарфҳои пластикӣ ва шишагӣ аз Sarstedt (Ирландия), Corning Life Sciences (Corning, NY), Greiner Bio One (Frickenhausen, Олмон) ва Pecon (Эрбах, Олмон) буданд.

Фарҳанги бофтаҳо ва шароити таҷрибавӣ

Ҳуҷайраҳои PC12 аз ATCC (<40 гузаргоҳҳо) дар суспензия дар муҳити RPMI 1640 бо NaHCO илова карда шуданд.3, 2 мм L-глутамин, зардоби 10% асп, 5% хунобаи гови ҳомила, 100 У/мл пенициллин ва 100 мкг/мл стрептомицин, дар инкубатори намнокшуда то 5% CO2 ва 37°С. Барои ҳама таҷрибаҳо, ҳуҷайраҳои PC12 аз 4 то 6 × 10 4 ҳуҷайра / см 2 дар колбаҳои 75 см 2, табақҳои Петри 10 см ё 15 см ва плитаҳои 96-чоҳ (ҳама бо коллаген IV дар 0,01 мг / мл пӯшонида шудаанд) кошта шуданд ё Лампаҳои шишагии 4,2 см (PeCon, Erbach, Олмон), ки бо омехтаи коллаген IV ва поли-D-лизин пӯшонида шудаанд [50]. Ҳуҷайраҳо дар ҳолати пайвастшуда то 3 рӯз нигоҳ дошта мешаванд. Дар як қабати ҳуҷайра О2 нисбат ба тазиқи хурд яксонтар тақсим карда мешавад, ки барои таваққуфи ҳуҷайраҳои PC12 маъмул аст [51], бинобар ин интизор мерафт, ки тағирёбии маълумот барои ҳуҷайраҳои часпида камтар бошад.

Таҷрибаҳои OGD ва OD

ВАО барои OGD ва O2 маҳрумият (OD) ба монанди [50] ба таври зерин омода карда шуданд. Хокаи DMEM (Sigma, каталоги рақами 5030) дар оби деионизатсияшуда барқарор карда шуд, бо 20 мм HEPES (pH 7.2) буфер карда шуд ва бо филтр стерилизатсия карда шуд. Бо истифода аз ин DMEM оддӣ, муҳити таҷрибавӣ бо илова кардани глюкоза 10 мМ, глутамин 2 мм ва пируват 1 мМ (моддаи OD) ё танҳо глутамин ва пируват (OGD) иборат буд. Зардоб илова карда нашудааст. Воситаҳо барои 20 соат дар 0% O мувозинат карда шуданд2 бо истифода аз истгоҳи гипоксия (Coy Laboratory Products, Grass Lake, MI, ИМА). Деоксигенатсияи васоити ахбори омма бо истифода аз сенсорҳои қаблан калибршудаи фосфоресентии dOxyBead ™ (Luxcel Biosciences, Корк, Ирландия) ва OpTech ™ O назорат карда шуд.2 Детектори дастии платина (Mocon, MN, ИМА) (Тасвири A1 дар файли иловагии 1).

Ҳуҷайраҳои пайвастшуда дар CO муқаррарӣ парвариш карда мешаванд2 инкубатор ба стансияи гипоксия (Кой) интиқол дода шуд ва бо 95% N мувозинат карда шуд.2 ва 5% CO2 (0% О2) дар 37°С. Муҳити афзоиш ба зудӣ бо медиаи деоксигенатсияшудаи OGD ё OD иваз карда шуд: 20 мл барои табақчаи Петри 15 см, 10 мл барои табақчаи 10 см, 1 мл барои пӯшиши 4,2 см, 100 мкл барои 1 чоҳи плитаи 96-чоҳ. Сипас ҳуҷайраҳо дар шароити аноксикӣ барои 20 дақиқа, 40 дақиқа, 1 соат, 2 соат ва 4 соат инкубатсия карда шуданд. Ҳуҷайраҳои назоратӣ дар давоми 1 соат ба васоити оксигендори OGD ё OD дар зери нормоксия дучор шуданд. Дар лаҳзаҳои нишондодашуда ҳуҷайраҳо зуд аз истгоҳи корӣ бароварда шуданд ва мавриди таҳлил қарор гирифтанд.

Насли китобхонаҳои ribo-seq ва mRNA-seq

Техникам профилактикии рибосомй мисли Инго-лия гузаронда шуд ва дигарон. [52] аммо бо чанд таѓйироте, ки дар Андреев зикр шудааст ва дигарон. [31]. Китобхонаҳо дар системаи Illumina HiSeq 2000 дар Институти геномикаи Пекин (BGI) тартиб дода шуданд.

Изолятсияи протеин ва таҳлили ғарбӣ

Таҳлили стандартии лизатҳои тамоми ҳуҷайра, ки бо истифода аз буфери RIPA таҳия шудааст, бо истифода аз таҳлили ғарбии blotting ҳамчун дар Жданов анҷом дода шуд. ва дигарон. [50]. Таҳлили маълумоти миқдорӣ бо барномаи ImageJ бо истифода аз сигналҳои α-тубулин барои ба эътидол овардан гузаронида шуд. Тасвирҳо бо барномаҳои Picasa, Photoshop ва Illustrator коркард карда шуданд. Тачрибахо дар се нусха гузаронда шуданд.

Андозаи ATP

ATP-и ҳуҷайравӣ бо истифода аз CellTiter-Glo® Assay (Promega) чен карда шуд, ки имкон медиҳад, ки дар нуқтаи ниҳоӣ таҳлили миқдорӣ дар ҳолати энергияи ҳуҷайра анҷом дода шавад. Реагентҳои маҷмӯаи қаблан омехташуда (100 мкл) ба ҳуҷайраҳо бевосита дар стансияи гипоксия илова карда шуданд. Плитаҳои дорои лизатҳои ҳуҷайра ба normoxia гузаронида шуданд. Пас аз ларзиши пуршиддат лизатҳо ба лавҳаҳои сафеди 96-чоҳи (Greiner Bio One, Frickenhausen, Олмон) интиқол дода шуданд ва люминессентсияи онҳо дар як хонандаи Victor 2 чен карда шуд.

Андозаи потенсиали мембранаи митохондриалӣ

Барои мониторинги потенсиали мембранаи митохондриалӣ (ΔΨm) мо ду зондҳои флюоресцентии тиҷоратӣ, TMRM ва JC-1 истифода кардем. Ҳангоми истифода дар консентратсияи хомӯшнашаванда (1 то 20 нМ), TMRM зуд дар митохондрияҳои поляризатсияшуда ҷамъ мешавад ва ба осонӣ аз митохондрияҳои деполяризатсияшуда озод карда мешавад. TMRM инчунин ба тағирот дар потенсиали мембранаи плазма ҳассос аст, бинобар ин барои таҳлили ΔΨm назорати иловагӣ лозим аст. Ҳангоми ҷамъшавӣ дар митохондрияҳои поляризатсияшуда, JC-1 тақсимшавӣ ба спектрҳои флуоресцентии сабз ва сурхро нишон медиҳад. Охирин танҳо аз ҷониби митохондрияҳои хеле поляризатсияшуда («энергетикӣ») истеҳсол мешавад, вақте ки JC-1 агрегатҳои J-ро ташкил медиҳад. Барои таъмини шароити баробар боркунӣ, мо ҳуҷайраҳоро дар 21% O ранг кардем2 барои 25 дақиқа (1 μM JC-1 ва 20 nM TMRM). Санҷиши TMRM дар давоми тамоми таҷриба дар васоити ахбори омма дар 20 нМ нигоҳ дошта шуд. Барои тасвир, пӯшишҳо бо ҳуҷайраҳо дар як камераи гипоксияи хурд дар тақрибан 1 мл муҳити оксигендор ё деоксигеншуда бо истифода аз се гаҷети ҳалқаи кремний ва як пӯшиши дуюм, ки бо ҳам пайваст карда шуда буданд, то бо пойгоҳи металлӣ бо пойгоҳи металлӣ ҳаво нагузаранд. кӯмаки сарпӯши буранда, ки дар расми A1D дар файли иловагӣ 1 нишон дода шудааст. Пас аз инкубатсия кардани ҳуҷайраҳо, тавре ки дар бахши Натиҷаҳо тавсиф шудааст, ΔΨm баъдан зуд (дар давоми 10 дақиқа) дар микроскопи флуорессенси майдони васеъ (Зейс, Олмон) назорат карда шуд. TMRM бо истифода аз 590 нм 10 мВт LED бо партовҳо дар 604 то 644 нм ба ҳаяҷон омад. JC-1 дар 488 нм ва 590 нм ба ҳаяҷон омада, ҳангоми ҷамъ кардани партовҳо мутаносибан дар 510 то 550 нм ва 604 то 644 нм.

Коркарди ибтидоии китобхонаҳои пайдарпай

Cutadapt [53] барои бартараф кардани пайдарпаии адаптер (CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCA) истифода шудааст. Пас аз он хонданҳо ба rRNA ва "хӯша дар" (ATGTACACGGAGTCGACCCGCAACGCGA) мувофиқ карда шуданд, то хонданҳое, ки аз ин манбаъҳо сарчашма мегиранд. Хонданҳо ба каталоги генҳои каламушҳои RefSeq, ки аз NCBI моҳи январи соли 2014 бор карда шуда буданд [54] бо галстук [55] мувофиқ карда шуданд. Параметрҳои ҳамоҳангсозии истифодашуда (−a -m 100 -v 2 -norc) буданд, яъне хонишҳо ба риштаи мусбӣ мувофиқ карда шуданд, ки на бештар аз ду номувофиқӣ ва на бештар аз 100 харитасозӣ дар як хонишро иҷозат медиҳанд.

Таҳлили экспрессияи генҳои дифференсиалӣ

Барои таҳлили экспрессияи дифференсиалӣ мо шумораи хонишҳоро ба иттиҳоди экзонии ген ҳисоб кардем [56]. Ҳар як хониш, ки ба яке аз транскриптҳои RefSeq мувофиқат мекунад, ки аз як ген сарчашма мегирад, новобаста аз шумораи изоформҳое, ки ба он мувофиқат мекунад, як маротиба ҳисоб карда мешуд. Чунин равиши марказии ген бояд ифодаи дақиқи ифодаи генро нисбат ба ҳамоҳангсозӣ ба дарозтарин транскрипт таъмин намояд, зеро ҳатто дарозтарин транскрипт метавонад ҳама экзонҳоро дар бар нагирад. Тақрибан 2% бештар хонданҳо ба иттиҳодияҳои экзонии генҳо дар муқоиса бо ҳамоҳангӣ ба дарозтарин транскриптҳо мувофиқат карда шуданд. Барои генҳои муайян (аз ҷумла Ннат, Ман 16, Кабинаи 1) мо бештар аз ду баробар зиёд шудани шумораи хондани рибо-секв ва mRNA-сеqро мушоҳида кардем.

Хонишҳои Ribo-seq ба координатҳои mRNA дар асоси ҷойгиршавии тахминии сайти A таъин карда шуданд. Ҷойгиршавии макони A дар 17 нуклеотид дар поёни 5′ охири хондани дарозии аз 29 то 33 бо фарогир ва 18 барои хондани дарозии 34 ва 35 муқаррар карда шуд. Хонишҳои Ribo-seq бо дарозии камтар аз 29 ё бештар аз 35 партофта шуданд. Барои генҳое, ки транскриптҳои дорои минтақаи рамзгузории тафсиршуда доштанд, мо танҳо хондани ribo-seq, ки ба он мувофиқанд, истифода кардем. Дар акси ҳол, хондани рибо-секв, ки ба тамоми транскрипт харита шудааст, дохил карда шуданд (дар хотир доред, ки барои mRNA-seq, хонишҳои мувофиқ ба тамоми транскрипт истифода мешуданд). Баъзе хондани рибо-сек ба зиёда аз як минтақаи транскрипт харита карда шуданд. Мо онҳоро ба маконҳои беназир дар асоси тартиби афзалиятноки зерин таъин кардем: acORF, 5′ пешво, 3′ UTR.

Тақрибан 80% хондани хариташудаи рибо-сек ба як ген, 9% ба ду ген ва 4% ба се ген харита карда шудаанд. Барои хондани mRNA-seq ин арзишҳо мутаносибан 84%, 8% ва 3% мебошанд. Хонишҳое, ки ба беш аз се ҷой мувофиқанд, партофта шуданд. Вазни хонишҳое, ки ба ду ё се ҷой мувофиқанд, мутаносибан 2 ва 3 кам карда шуд.

Нормализатсия (аз нав миқёси ҳисобҳои хондан барои бартараф кардани фарқиятҳо аз ҳисоби шумораи умумии хондани хариташуда) ва таҳлили дифференсиалӣ бо равиши шабеҳ ба равиши қаблан истифодашуда гузаронида шуд [31]. Хондан ба як хусусияти намуна мувофиқат мекунад к бо коэффициенти азнавсозй зиёд карда шуданд х[к]/дақ(х[i]) дар куҷо х[к] шумораи ҳама пайдарпаии хондан ба ҳамаи хусусиятҳои дохили намуна мувофиқат мекунад к, ва дақ(х[i]) шумораи ҳамаи хонданҳо, ки ба ҳамаи хусусиятҳои намуна мувофиқат мекунанд i ки шумораи камтарини мутолиахо дорад. Ин миқёси миқёс барои маълумоти mRNA-seq ва ribo-seq мустақилона анҷом дода шуд, аммо ҳарду репликатсия якҷоя ба эътидол оварда шуданд, то муқоисаи байни репликаҳо имкон диҳад.

Барои муайян кардани генҳои DE мо тағироти Z-холҳои таносуби логро анҷом додем [16]. Генҳо дар зарфҳои 300 дар асоси сатҳи ҳадди ақали ифодаи онҳо гурӯҳбандӣ карда шуданд (шумораи ҳадди ақали mRNA-seq, ribo-seq ё ҳарду вобаста ба таҳлил). Параметрҳои тақсимоти тағирёбии ифода барои ҳисоб кардани Z-холҳои маҳаллӣ барои ҳар як ген истифода шуданд. Ген ҳамчун DE тасниф карда шуд, агар (З 1 + З 2)/2 > Т ва DE коҳиш ёфт, агар (З 1 + З 2)/2 < −Т, дар куҷо З 1 ва З 2 мебошанд Z-холҳои барои як ген дар ду реплика ба даст ва Т остона аст. Остона Т дар асоси FDR-и дилхоҳ муқаррар карда шуд. Шумораи мусбатҳои бардурӯғ ҳамчун шумораи генҳо ҳисоб карда шуд, ки барои онҳо ( 1| + |З 2|)/2 &гт Т кай З 1 З 2 < 0 (барои тасвири графикии расмиёт ба расми 2В нигаред).

Аз сабаби номувофиқӣ, ғаразҳои амплификация ва тағирёбии суръати дарозшавӣ дар байни шароит, шумораи умумии хондани ба ген хариташуда ҳатман ифодаи дақиқи сатҳи ифодаи он нест. Масалан, қатъ шудани рибосомаи аз ҳолати сахт вобаста дар макони мушаххас метавонад ба танзими бардурӯғ оварда расонад. Ген танҳо ба таври устувор танзимшаванда ҳисобида мешуд, ки агар он пас аз хориҷ кардани координатҳои acORF, ки ба се қуллаи зичии баландтарини зичии рибосома барои ҳар як транскрипти он мувофиқат мекунанд, танзим шуда бошад. Таҳлили таъсири ҳадди аксар истисно дар ошкор кардани генҳои ба таври дифференсиалӣ ифодашуда дар расми A10 дар файли иловагии 1 тасвир шудааст. Дар ин тасвир генҳо бо функсияи пайванди Scipy бо истифода аз меъёрҳои пайванди “якгона” ва метрикаи масофаи сутуни “ҳамминг” гурӯҳбандӣ карда шудаанд.

Таҳлили шабоҳати ҷуфтии профилҳои рибо-секви mRNA-ҳои инфиродӣ

Монандии дугонаи байни ду профили aCORF ribo-seq тавассути ҳисоб кардани коэффисиентҳои коррелятсияи Пирсон барои зичии изи маҳаллии профилҳои муқоисашаванда арзёбӣ карда шуд. Барои ин таҳлил танҳо хонишҳои рибо-сек, ки ба таври равшан мувофиқ карда шудаанд, истифода шуданд. Мавқеи хонишҳо, ки ба минтақаи acORF мувофиқат мекунанд, на дар сатҳи нуклеотидҳо, балки дар кодон муайян карда шуд. Дар ин таҳлил танҳо вариантҳои дарозтарини транскрипти ҳар як ген, ки зичии миёнаи acORF аз як изи пай дар як нуклеотид дар ҳар ду намунаи муқоисашуда зиёд буд, истифода шуданд. Барои таҳлил дар расми A8B дар файли иловагии 1, раванд бо истифода аз ҳамоҳангсозӣ, ки тавассути интихоби тасодуфии шумораи муайяни хонданҳо барои ҳар як mRNA аз маълумоти воқеӣ ҳосил шудааст, такрор карда шуд. Дар ҳар як муқоисаи ҷуфтӣ, барои шароитҳое, ки фарогирии пайдарпайи баландтар доранд, хонишҳои ribo-seq аз ҳамбастагии аслӣ то он даме, ки шумораи хонданҳо ба он баробар шавад, ки барои шароите, ки фарогирии пайдарпайии камтар доранд, интихоб карда шуданд. Барои тавлиди тақсимот коэффисиенти миёнаи дугонаи Пирсони ин профилҳо истифода шудааст.

Муайян кардани генҳо бо хотимаи ихроҷшуда

Профилҳои транскриптҳо, ки шумораи умумии хонишҳои рибо-секв ба 3′ UTR аз 20 зиёд буданд, дастӣ тафтиш карда шуданд. Ҳамоҳангҳои номуайян дохил карда шуданд. Интихоб бидуни огоҳии пешакӣ дар бораи шахсияти қатъи кодон ва контексти нуклеотидҳо анҷом дода шуд. Контексти сайтҳои қатъкунӣ бо истифода аз логотипи пайдарпай, ки бо weblogo таҳия шудааст, визуалӣ карда шуд [30]. Таносуби зичии хониши ribo-seq (Мувофиқшавӣ дар ORF/Дарозии ORF) дар acORF ва ORF поёноби барои чен кардани самаранокии хондани кодон боздошта истифода шудааст.

Муайян кардани uORF-ҳои тарҷумашуда

Эҳтимолияти тақсимоти генҳои хеле тарҷумашуда бо uORF-и тарҷумашуда ва бе uORF (Расми 4A) аз ҳамон тақсимот интихоб карда мешаванд, аз ҷониби санҷиши рутбаи ҷамъи Wilcoxon, ки бо функсияи ranksums дар китобхонаи Scipy амалӣ карда шудааст, ҳисоб карда шуд. Барои ғанӣ гардонидани генофонди онҳое, ки дорои uORF-ҳои танзимкунанда доранд, мо тағирёбии маркази зичии рибосомаро таҳлил кардем [31]. Барои муайян кардани маркази зичии рибосомаҳо мо аввал "профилҳои фишурдашуда"-ро истеҳсол кардем, ки дар он ҳар як координати профили mRNA, ки ҳадди аққал як нуқтаи вақтро дар бар намегирад, хориҷ карда шуд. Ин бартарии тавлиди натиҷаи мустаҳкамтар бо шумораи ками хонданро дорад. Маркази зичии рибосома ҳамчун координати ҳадди ақали профили фишурда муайян карда шуд, ки дар он шумораи ҷамъи хониши рибо-секв мувофиқи болооби он аз шумораи умумии хондан дар поёноби он зиёд аст. Ҷойивазкунии марказ нисбат ба дарозии минтақаҳои тарҷумашудаи mRNAs чен карда шуд, яъне ба шумораи координатҳо бо ҳадди аққал як ҳамоҳангии хондани рибо-секв тақсим карда шуд. Тағйирёбии маркази зич барои ҳама транскриптҳои рамзгузории тафсиршуда бо ҳамбастагии хониши бештар аз 64 рибо-секв ба даст оварда шуд. Профилҳои зиёда аз 200 транскрипт бо тағирёбии миёнаи зичии бештар ба 5 ′ пас аз 1 соати OGD (Расми 4B) ​​дастӣ арзёбӣ карда шуданд.

Азбаски қавитарин давраи трилетӣ бо хондани рибо-секв дар дарозии 31 нуклеотид мушоҳида шудааст, танҳо онҳо барои таҳлили сигнали даврии сегона истифода мешуданд. Барои муайян кардани ҳолатҳое, ки давраҳои ғайритиҷоратӣ доранд, мо мувофиқатҳоро ба 50 координатаҳои аввали acORF истифода кардем. Барои аксари транскриптҳо тақрибан 20% хонишҳо ба мавқеи субкодони сеюм мутобиқ карда шудаанд, ҳиссаи бештари хондани ribo-seq, ки ба мавқеи сеюми субкодон мувофиқат мекунад, ҳамчун нишондиҳандаи таҳрифи даврии сегона ҳисобида мешуд. Транскриптҳое, ки камтар аз 50 координата доранд, бо хондани рибо-сек мувофиқ аз ин таҳлил хориҷ карда шуданд.

Истеҳсоли профили метаген дар ҷойҳои оғоз ва хотима

Транскрипте, ки барои тавлиди профили метаген истифода мешавад, барои қонеъ кардани меъёрҳои зерин интихоб карда шуд: 1) он дар байни вариантҳои дигари транскрипт барои гени мувофиқ дарозтарин аст; 2) он ҳадди аққал 100 ҳамоҳангии хариташуда дорад 3) дарозии он аз 600 нуклеотид зиёд аст 4) дарозии ҳам пешвои 5′ ва ҳам 3′ UTR аз 45 нуклеотид зиёд аст. Ҳар як профили транскрипти инфиродӣ 45 нуклеотид дар боло аз макони оғозёбӣ ва 45 нуклеотид дар поёни макони қатъкунӣ бо зичии миёнаи генҳо пеш аз ҷамъоварӣ бо роҳи муайян кардани миёнаи мушаххаси мавқеъ ба эътидол оварда шуд. Ин ба шумораи миёнаи ҳамоҳангсозӣ дар як кодон табдил дода шуд.

Таҳлили роҳҳои биологӣ

3,000 ген, ки пас аз 60 дақиқаи OGD (DE зиёд ва DE коҳиш ёфт) ба ҳисоби миёна мутлақи Z-Ribo-seq пайдо шуданд, барои онтологияи генҳо ва таҳлили ғанисозии роҳи KEGG бо истифода аз DAVID [57] истифода шуданд. Аҳамияти омории ғанисозии генҳо барои санҷиши сершумор бо истифода аз усули Бенҷамини-Хочберг ислоҳ карда шуд. Генҳои DE, ки ба фосфоризатсияи оксидшаванда тааллуқ доранд ва давраи TCA дар расмҳои A4 ва A5 дар файли иловагии 1 қайд карда шудаанд.

MRNAs дорои rHRE ва ҳассос ба mTOR

Рӯйхати генҳои ба таври трансмиллӣ танзимшавандаи PP242 аз расми иловагии Hsieh ва дигарон. [19] ҳамчун маҷмӯи генҳои ҳассос ба mTOR истифода шудааст. Маҷмӯи транскриптҳои дорои rHRE аз маълумоти иловагии 2-и Uniacle сохта шудааст ва дигарон. [8] талаб кардани ҳадди аққал се PAR-CLIP хондани ҳадафи EPAS1/RBM4.

Ҳама ҳисобҳо ва қитъаҳо бо скриптҳои фармоишии python бо истифода аз китобхонаи Matplotlib таҳия карда шуданд.

Дастрасии маълумот

Пайдарпайии китобхонаҳои ribo-seq ва mRNA-seq cDNA дар NCBI Genome Expression Omnibus (GEO) таҳти рақами пайвастшавӣ GSE60752 нигоҳ дошта шудаанд.


Видеоро тамошо кунед: Задача на экологию 2 (Ноябр 2022).