Маълумот

Чӣ мешавад, агар ягон бактерия ба монанди Streptococcus mutans вуҷуд надошта бошад

Чӣ мешавад, агар ягон бактерия ба монанди Streptococcus mutans вуҷуд надошта бошад


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Агар касе ҳамаи бактерияҳоро аз байн бурд Streptococcus mutans дар даҳони вай бо гуруснагии тӯлонӣ ё бо ягон усули кимиёвӣ, оё вай ҳеҷ гоҳ чунин бактерияҳо надорад?

Ба фикри ман, зеро С.мутанс танҳо тавассути дандонҳои инсон паҳн мешавад ва агар баъзеҳо дар ҳаво вуҷуд дошта бошанд, ҳуҷайраҳои сафеди хун метавонад ҳамаро аз ҳаво комилан кушанд, зеро онҳо хеле каманд.

Оё ин фарзияи аблаҳии ман имконпазир аст?

Жавобингиз учун олдиндан раҳмат.


Тавре ки Шигета қайд кард, роҳи амалии пешгирӣ аз сирояти байни одамон аз дигар одамон вуҷуд надорад. Фарз мекунем, ки бо ҷодугарӣ шумо тамоми бактерияҳои даҳони худро нест мекунед, роҳҳои зиёде барои аз нав эмкунӣ вуҷуд дорад, ки шумо бидуни зиндагӣ дар изолятсияи шадид аз он канорагирӣ карда наметавонед.

Рӯйхати мукаммали ҳамаи роҳҳое, ки шумо метавонед дубора эмкунӣ кунед:

  • бусидан
  • лесидан
  • обҳои аэрозолӣ аз сулфа/ атса задан
  • хӯрдани хӯроке, ки ба ҳамин монанд дучор мешаванд
  • Ба чизи олудашуда ламс кунед ва сипас дандонҳои худро тоза кунед
  • Аслан дар даҳони шумо чизеро, ки одами дигар ламс кардааст, гузоред

Одамони дигар аз чизҳое, ки ламс мекунанд ва аз он чизҳое, ки нафас мегиранд, гилро пайдо мекунанд. Он чизҳоро бидуни пухтан нафас гирифтан ё хӯрдан мумкин нест. Сабзавотҳои тару тоза нест.

Ҳуҷайраҳои сафеди хун ё системаи иммунии шумо дар маҷмӯъ кӯмак намекунанд, зеро S. mutans аллакай барои зиндагӣ дар оби даҳони шумо мутобиқ карда шудааст ва (ба маълумоти ман) ягон ҷузъҳои мутобиқшавандаи системаи иммунии фаъол дар гилрози шумо вуҷуд надоранд.


Streptococcus Mutans: сабабҳо, таъсирот ва интиқол

Streptococcus mutans бактерияест, ки барои пуфакҳои дандонпизишкӣ дар одамон масъул аст. Таксономияи пурра ё таснифи организм ин Bacteria Firmicutes Bacilli Lactobacillales Streptococaceae Streptococcus Mutans мебошад (1). Аз номи клиникии S. mutans дар бораи бактерияҳо каме фаҳмидан мумкин аст. Майдон ва салтанат Бактерияҳо мебошанд, яъне S. mutans як организми якҳуҷайра аст, ки ядрои муайян надорад. Филми Firmicutes ба мо мегӯяд, ки мембранаи девори ҳуҷайра қавӣ, зич ва эҳтимолан грам-мусбат аст. Курси Bacilli дар бораи шакли асои бактерияҳо сӯҳбат мекунад. Тартиби Lactobakillales ва он аз Lactobakillales аст "бактерияҳои кислотаи лактикӣ". Оилаи Streptococaceae S. mutans-ро ба анаэроби грам-мусбат, факултативӣ, одатан ғайриҳаракат ва дар дохили ҷуфтҳо, занҷирҳо ё тетрадаҳо тасниф мекунад. Дар ҷинси стрептококкҳо мо медонем, ки бактерияҳо дар ҷуфтҳо ё занҷирҳо ташаккул меёбанд ва одатан барои васеъшавӣ муҳити мураккаби фарҳангиро талаб мекунанд. Ниҳоят, навъҳои Мутанҳо нишон медиҳанд, ки бактерияҳо дар даҳони мо зиндагӣ мекунанд ва ковокиҳои даҳонро ба вуҷуд меоранд. Кавитаҳо пӯсидаи дандонҳои дарозмуддат мебошанд, ки дар сафедаҳои марворид сӯрохҳо мекунанд ва одатан дардоваранд. Онҳо метавонанд ба мушкилоти ҷиддии саломатӣ оварда расонанд.

Морфологияи S. mutans ё шакл ва сохтори организм маҳз аз он иборат аст, ки чаро ин бактерияҳо ковишҳоро ин қадар хуб эҷод карда метавонанд ва чаро куштан ин қадар душвор аст. Диаметри S. mutans аз 0,5 то 0,75 микрометр, коккҳои грам-мусбат, сохтори стрепто (1, 2). Барои ҷойгир кардани андозаи S. mutans ба перспективӣ, микрометр як миллионум аст, ки чӣ қадар як метр калон аст. Ҳуҷайраҳои грам-мусбат дар санҷиши доғи Грам аз бунафши булӯр арғувон мешаванд. Ҳуҷайраҳои грам-мусбат сурх мешаванд, зеро сохтори девори ҳуҷайра сатҳи ғафси пептидогликан, полимере, ки аз занҷирҳои полисахарид ва пептидҳо сохта шудааст, иборат аст(1). Пептидогликан бунафшаи булӯрро нигоҳ медорад ва намегузорад, ки он шуста шавад. Ин ҷузъи сохтори девори ҳуҷайра инчунин ба пешгирии лизиси осмос кӯмак мекунад. Ин маънои онро дорад, ки ҳуҷайра аз номутавозунии консентратсияи ҳалкунанда дар ҳуҷайра ба беруни ҳуҷайра намедарояд. Бактерияҳои стрептококкҳо, аз қабили S. mutans, коккҳо ё бактерияҳои даврашакл мебошанд, ки ба таври дастаҷамъӣ дар як хат мечаспад ё созишномаи стрепто. Ин организми ягонаи ҳуҷайра дар ситоплазмаи худ ядро ​​ё органелл надорад. Маводи ирсӣ дар риштаҳои ягона нигоҳ дошта мешавад, ки ҳангоми тақсимоти бинарӣ такрор мешаванд, яъне ҳуҷайра ҳамон тавр дубора тавлид мекунад, зеро он спораҳо тавлид намекунад. Ин бактерия капсула дорад, ки аз полисахарид ва шакар декстран иборат аст. S. mutans як сафедаи заруриро дар рӯи он истифода мебарад, то худро ба дандон часпонад, бактерияҳо пас аз он ин капсулаи декстранро зиёд мекунанд, ки баръало як шлам аст, ки бактерияҳоро ба сирри дандон мепайвандад. Дар дохили ин шлам ҷойгир аст, ки дар асл бактерияҳо тақсим мешаванд ва колонияҳо ба вуҷуд меоранд, ин биофилм аст. S. mutans як анаэроби факултативӣ мебошад, бинобар ин бактерияҳо ҳаворо истифода мебаранд, агар он мавҷуд бошад, аммо барои зинда мондан ба оксиген ниёз надорад(2). Ин бактерияҳои мезофилӣ дар ҳарорати аз 18 то 40 дараҷа (64 то 104 дараҷа Фаренгейт) афзоиш меёбад (1). Аксарияти морфологияи S. mutans кӯмак мекунад, ки он комилан тарҳрезӣ шавад, то дар ин макони шадид ҳамчун даҳон зиндагӣ кунад.

S. mutans метавонад паразити ҳайвоноти хонагӣ бошад, махсусан дар ҳайвоноти хонагӣ, ки парҳези карбогидраташон баландтар аст. Азбаски ин бактерия паразит аст, барои зинда мондан ба мизбон ниёз дорад ва координатор аз бактерия азоб мекашад. С.мутанс сабаби асосии кафидани даҳон буда, бештар дар рӯи дандонҳо вомехӯрад. Он воқеан дар тамаркузи бештар дар тарқишҳои табиӣ ва шикофҳои дандон пайдо мешавад. Дар ин сатҳҳо S. mutans лавҳа ба вуҷуд меорад. Плака як филми биологӣ мебошад. Биофилм ин микроорганизмҳоест, ки дар дохили матритсаи берун аз ҳуҷайра бо рӯи ва инчунин ба ҳамдигар часпида мешаванд, ки одатан худ аз худ истеҳсол мешаванд. Плака дар се марҳила ташкил карда мешавад. Аввал плёнка ё плёнка сохта мешавад. Пелликул капсулаи полимерии декстран дар бактерияҳо мебошад. Ин инчунин матритсаи берун аз ҳуҷайраи биофилм мегардад. Дуюм, пайвасти ҳуҷайра ба сатҳи S. mutans бо дандон (1). Пештар S. mutans баъдтар ба аввалин S. mutans, ки ба дандон гирифта пайваст. Ин биофилми лавҳа аз 300-500 ҳуҷайра иборат аст(1). Рушди лавҳа ба зудӣ пас аз шустани сатҳи дандон оғоз меёбад ва барои пурра пухта шудани лавҳа аз чор то ҳафт рӯз лозим аст. Танҳо пас аз як то ду маротиба эҷоди бефосила, лавҳа намоён мешавад. Плака метавонад калсина ва сахт гардад ва ҳисобкунакро ташкил диҳад. Плака дар болои ҳисобҳо инкишоф меёбад (3).

С.-и мутантҳо мубодилаи хеле содда доранд. Метаболизм равандҳои моддаест, ки дар организм барои нигоҳ доштани ҳаёт ба вуҷуд меоянд. S. mutans сахарозаро аз ғизои мизбон ба глюкоза ва фруктоза ҷудо мекунад ё мебурад(1). Онҳо ин ифлоскунандаҳои ғизоро бо каналҳо дар мембранаи девори ҳуҷайраи худ мехӯранд, ки ба молекулаҳо барои убур кардани девори ҳуҷайра ва ворид шудан ба ҳуҷайра кӯмак мекунанд (4). Агар ягон ифлоскунандаи ғизо мавҷуд набошад, бактерияҳо ферментеро ихроҷ мекунанд, ки бофтаҳои муайянро дар муҳити худ вайрон мекунад ва вайрон мекунад. Фруктоза, ки аз сахароза ба вуҷуд омадааст, фермент карда мешавад ва ҳамчун манбаи нерӯ барои афзоиши бактерияҳо истифода мешавад. Шакари хун дар полимери декстран полимеризатсия мешавад, ки ин матритсаи берун аз ҳуҷайра мебошад, ки S. mutans-ро ба сири дандон семент мекунад(1). Шлами декстран метавонад баъдтар дубора ба глюкоза деполимеризатсия шавад. Ин шакар ҳамчун манбаи карбон истифода мешавад, ки боиси пайдоиши кислотаи лактикӣ мегардад. Кислотаи лактикӣ дар лавҳа сири дандонҳоро декалсиф мекунад ва ба кафидани дандонҳо ва ҳамлаҳои дандон оварда мерасонад.

Кофӣ, ки аз ҷониби S. mutans ба вуҷуд омадааст, боиси бисёр аломатҳои ногувор мегардад ва метавонад боиси мушкилоти бештари саломатӣ гардад. Вақте ки пуфак нав оғоз меёбад, шумо шояд ягон аломати мушоҳидашаванда надошта бошед, ин боиси пайдо шудани сӯрохиҳоро душвор мекунад, агар шумо мунтазам ба духтури дандон муроҷиат кунед. Вақте ки ковок калон мешавад, он метавонад дарди дандон, ҳассосияти дандон ба чизе ба мисли ҳавои нафаскашӣ, дард ҳангоми хӯрдан ё нӯшидани машруботи қанд, дард аз моддаҳои гарм ё зимистон, дард ҳангоми газидан ё газидан ва талх услуб дар даҳони шумо. Кавитаҳо сӯрохиҳои намоён, доғ дар дандон ва бӯи бад эҷод мекунанд, ки метавонанд ба худбаҳодиҳии паст ва робитаҳои сусти иҷтимоӣ оварда расонанд. Агар холигоҳҳо ба қадри кофӣ амиқ шаванд, то ба камераи селлюлозаи дандон дохил шаванд, он метавонад боиси дандонҳои абсцессшуда ё олуда гардад. Кофӣ боиси илтиҳоби дили дандонҳо мегардад ва сироят пайдо мешавад. Инфексия ҷайби чиркро ба вуҷуд меорад, ки ин дар асл абсцесс аст. Абсцессҳо метавонанд ба милки ва устухони ҷоғ паҳн шаванд ва боиси дард ва варам шаванд. Баъзан дарди дандонҳои абсцессӣ чунон шадид аст, ки бо доруҳои дардовар бартараф карда намешавад. Агар абсцесс зуд паҳн шавад, он метавонад боиси табларза ва варамкунии пӯсти рӯй гардад. Агар абсцесс пайдо шавад, он метавонад аломатҳои зукомро ба вуҷуд орад. Ин абсцессҳо, ки аз сӯрохиҳои S. mutans ба вуҷуд омадаанд, метавонанд ба бемории дигари минтақаи даҳон, бемории пародонт оварда расонанд. Бемории пародонтӣ ба ду гурӯҳ тақсим мешавад: гингивит ва пародонтит(5). Гингивит камтар вазнин ва бештар паҳн мешавад, ин сирояти бофтаҳои резини аст. Пародонтит метавонад як вокуниши илтиҳобӣ бошад, ки ба лавҳаи пешгӯинашаванда, ки боиси аз дандон канда шудани милки дандон мегардад ва боиси норасоии устухон дар даҳон мегардад. Дар ҳолатҳои шадид, резини ба қадри кофӣ коҳиш меёбад, то тамоми решаи дандонро фош кунад. Тамоми саломатии дандонҳои инсон ба саломатии тамоми бадан ба таври ҷиддӣ алоқаманд аст. Бемориҳои дил, инсулт, эндокардит, оғози бармаҳал ва вазни кам, диабети қанд ва остеопороз ҳама бо бемориҳои пародонт ва дигар сироятҳои микробҳои холигоҳи даҳон зич алоқаманданд. S. mutans метавонад баъзе мушкилоти ҷиддии тиббиро ба вуҷуд орад, агар саломатии дурусти дандонҳо идора карда нашавад. Ҷарроҳи асосӣ пӯсидаи дандонҳоро "эпидемияи хомӯш" номидааст.

Интиқол

S. mutans аз 30 то 60 фоизи флораи муқаррарии дандонпизишкии калонсолонро ишғол мекунад(4). Ин маънои бисёр микроорганизмҳои муқаррариро, ки дар холигоҳи даҳон зиндагӣ мекунанд, S. mutans яке аз маъмултаринҳост. Мардон ва занон дар даҳони худ консентратсияи бештари ин бактерия доранд, аммо кӯдакон ба он бештар осебпазиранд (1). Аз парастор ба кӯдак интиқоли маъмултарини С. Он метавонад амудӣ ё аз модар ба кӯдаки шумо фавран пеш аз таваллуд ва пас аз таваллуд дода шавад. Ҳамин тавр, вақте ки модар миқдори зиёди бактерияҳои S. mutans дорад, имконияти хубе вуҷуд дорад, ки кӯдак ин хислатро мерос гирад. Бактерияҳо ҳатто метавонанд ба таври уфуқӣ ё аз як шахс ба шахси дигар гузаранд. Аз як кас ба каси дигар С.-мутансро мукаммал мегардонад. Агар парастор бо кӯдак зарфҳои хӯрокхӯриро тақсим кунад, онҳо ба он кӯдак бактерияҳои S. mutans медиҳанд. Агар кӯдак дандон надошта бошад, бактерияҳо дар ҷӯякҳои забон мустамлика мешаванд (1). Кавитаҳо бемории маъмултарини кӯдакон мебошанд. Кӯдак нисбат ба нафастангӣ панҷ маротиба бештар аз сӯрохиҳо гирифтор мешавад.

Пешгирӣ ва табобат

Кавитаҳо сабаби 50 фоизи тамоми муолиҷаи даҳон мешаванд ва ҳар сол ду миллиард доллар барои табобат сарф карда мешаванд (1). Муолиҷаи S. mutans бо дору хеле душвор аст, зеро ҳуҷайраҳои биофилм ба антибиотикҳо 1000 маротиба бештар таҳаммул мекунанд(4). Аз сабаби омилҳои вирусии он барои С. Он дорои гликани ҳалнашавандаи оби ошомиданӣ мебошад, таҳаммулпазирии кислота дорад ва кислотаи лактикӣ истеҳсол мекунад. Гарчанде ки мо аз бактерияҳо халос шуда наметавонем, мо метавонем бемориҳои онро пешгирӣ ва табобат кунем. Ҳар рӯз на камтар аз ду маротиба, хусусан пас аз табақҳо, шустушӯй кардан ва ҳар рӯз ҳадди аққал як бор пошидани ришта метавонад ҷилавгирӣ аз ангезаҳои S. mutans гардад. Агар ягон заррачаҳои ғизоӣ барои шикастани бактерия мавҷуд набошад, он наметавонад кислотаи лактикиро барои шикастани сирдор ташкил кунад. Табобатҳои фторидҳо инчунин дар пешгирии сӯрохҳо тавассути кондитсионерии сирдори дандон кӯмак мекунанд. Сирри дандон моддаи аз ҳама минералии бадани инсон аст. Фторид инчунин метавонад баъзе декалсификатсияро, ки аз кислотаи лактикӣ ба вуҷуд омадааст, тавассути фаъолияте, ки реминерализатсия ном дорад, табдил диҳад. Барои тоза кардан ба духтури дандон ҳар ним сол як маротиба муроҷиат кардан афзалтар аст. Стоматологҳо ва гигиенистҳои нигоҳубини дандонпизишкӣ метавонанд барои пешгирӣ кардани нобудшавии S. mutans кӯмак расонанд ва метавонанд дар марҳилаҳои аввал ковокҳоро пайдо кунанд. Табибони дандонпизишк инчунин метавонанд ба рахнаҳои паҳлӯи дандонҳои молярҳо пломба гузоранд. Пломба як қабати борикест, ки ба пластикӣ монанд аст, ки аз пайдо шудани лавҳа дар худи дандон пешгирӣ мекунад. Ҳар кас бактерияҳои S. mutans дорад ва ягона коре, ки касе метавонад барои пешгирии ковишҳо анҷом диҳад, ин кам кардани таъсири ферментатсияи кислотаҳо мебошад, ки ин бактерияҳо ба вуҷуд меоянд. Вақте ки ковокҳо пайдо мешаванд, духтури дандон пломба медиҳад. Пармакунии дандонпизишк майдони хурди атрофи пуфакро барои мувофиқ кардани амальгам ё пуркунии таркиби дар дохили сӯрох ё дивоте, ки аз кислотаи лактикӣ сохта шудааст, мепарад. Пломбаҳои амалгам ин пуркунии нуқрае хоҳанд буд, ки бисёриҳо доранд. Онҳо танҳо устувор, қавӣ, 10-15 соли пештара мебошанд ва нисбат ба пуркунии омехта камтар арзиш доранд. Ҷиҳати манфии пуркунии амалгама иборат аст аз он аст, ки онҳо дандонҳоро ранг мекунанд, пораҳо ва шикастанҳо, аксуламалҳои аллергиро ба вуҷуд меоранд ва чаҳорчӯбаи дандонҳоро вайрон мекунанд. Пломбаҳои таркибӣ беҳтар ба назар мерасанд, зеро онҳо барои як ранг бо дандон тарҳрезӣ шудаанд. Инчунин, онҳо барои дастгирии беҳтар аз ҷиҳати кимиёвӣ пайваст карда мешаванд ва пеш аз гузоштани анҷом додани дандон камтар бояд хориҷ карда шаванд. Манфии пуркунии амалгама дар он аст, ки онҳо бояд тақрибан ҳар панҷ сол иваз карда шаванд ва арзиши пуркунии амалгама дучанд аст. Агар холигоҳ хеле бад бошад, ба мутахассиси дандонпизишк лозим аст, ки канали асосӣ анҷом диҳад ва асабҳоро аз дандон дур кунад. Он дандон мурда мешавад, аммо дигар дард намекунад. Дар баъзе ҳолатҳо, ба духтури дандон танҳо лозим аст, ки дандонро берун кунад.

Профессори Мактаби биологияи дандонпизишкии Флорида Ҷеффри Ҳилман роҳеро пайдо кард, ки бактерияҳои S. mutans-ро ба тавре ки бактерияҳо табдил додани шириниро ба кислотаи лактикӣ кам кунанд. Бе кислотаи лактикӣ пуфак вуҷуд надорад. S. mutans ва одамон то он даме, ки дар парҳези мо глюкозаи тозатар мавҷуд буд, дар оромӣ якҷоя зиндагӣ мекарданд. Бинишҳои Ҳилман аз он иборат аст, ки беморон бактерияҳои бартаридоштаи тағирёфтаро дар даҳони худ чанд дақиқа мешӯянд ва пас аз он сақичро хоидан барои фаъол кардани он иборат аст. Дар он вақт, он шахс барои як умр холӣ хоҳад буд. Телефони Ҳилман ин "табобати алтернативӣ" номида мешавад(6).

S. mutans метавонад ба зудӣ дар даҳони мо аз сабаби омилҳое мисли сохтори девори ҳуҷайраи пептидогликани он зиндагӣ кунад, ки маънои онро дорад, ки гузариши он душвор аст ва полисахарид ва капсулаи қанди декстран, ки бактерияҳоро ба сафедаҳои марворид часпида, матритсаи онро ҷудо мекунад. Худи ҳамон шлами декстран кислотаи лактикиро ба вуҷуд меорад, ки калсификатсияи сирдори моро вайрон карда, холигоҳҳо ба вуҷуд меорад. Кофӣ метавонад боиси мушкилоти ҷиддии саломатӣ гардад. Барои пешгирӣ кардани бемориҳое, ки аз ҷониби С. Шустушӯй, шустушӯй ва боздид аз дандон беҳтарин чизе барои пешгирии бемориҳо хоҳад буд. Шояд рӯзе бозёфти Ҳилман истифода шавад, то инсонҳо ва мутантҳои Streptococcus дубора дар оромӣ зиндагӣ кунанд.

  1. Streptococcus mutans. MicrobeWiki. Донишҷӯи донишгоҳ асбоби микробиологияро таҳрир кард. Microbewiki. Кенон. edu/index. php/Streptococcus_mutans Таҳрири 2014
  2. Хизер Пейн. Streptococcus mutans. Миссури S&T. веб. мст. таълим/


Системаи фосфоэнолпируват вобаста ба фосфотрансфераза интиқолдиҳандаи асосии мальтоза дар Streptococcus mutans ▿

Мо хабар медиҳем, ки системаи фосфоэнолпируват вобаста ба фосфотрансфераза, MalT интиқолдиҳандаи асосии мальтоза мебошад. Streptococcus mutans. MalT инчунин ба азхудкунии мальттриоза мусоидат мекунад. Азбаски мальтоза ва мальтодекстринҳо маҳсулоти таназзули крахмал дар оби даҳон мебошанд, қобилияти гирифтан ва фермент кардани ин карбогидратҳо метавонад ба кариесҳои дандонпизишкӣ мусоидат кунад.

Ферментатсияи карбогидратҳо аз ҷониби бактерияҳо, аз қабили Streptococcus mutans, ва истеҳсоли мувофиқи кислотаҳои органикӣ барои кариесҳои дандонпизишкӣ дар одамон (7). Таҳлили пайдарпаии геноми анҷомёфтаи як С Штамм нишон дод, ки ин бактерия қобилияти интиқол ва мубодилаи миқдори зиёди карбогидратҳоро дорад (2). Аммо, нақши дақиқи бисёре аз маҳсулоти генӣ маълум нест ва ҷанбаҳои зиёди он С физиология ва мубодилаи карбогидратхо хануз пурра фахмида нашудааст. Масалан, гарчанде С метавонад мальтозаро фермент кунад ва онро ҳамчун манбаи ягонаи карбон истифода барад (19), маълум нест, ки мальтоза аз ҷониби ин бактерия чӣ гуна гирифта мешавад.

Мальтоза ва мальтодекстринҳо карбогидратҳо мебошанд, ки дар холигоҳи даҳон мавҷуданд, зеро крахмали парҳезӣ тавассути α-amylase, як ферменти фаровон дар даҳон шикаста мешавад (8). Аз ин рӯ, ферментатсияи ин карбогидратҳо тавассути С метавонад ба рақобатпазирии онҳо мусоидат намояд С ва ба кариесҳои дандонпизишкӣ. Ҷустуҷӯҳои BLAST (3) нишон медиҳанд, ки дар оилаи интиқолдиҳандаи кассетаи ҳатмии ATP (ABC) ду узви вуҷуд доранд. С ки ба характеристика монанд мебошанд Escherichia coli Пермезаи мальтоза (Мал) (5). Хабар дода шуд, ки аз ҷониби яке аз онҳо, интиқолдиҳандаи мубодилаи миқдори зиёди шакар (Msm) қабули мелибиозаро мальтоза бозмедорад (20), ки нишон медиҳад, ки мальтоза инчунин тавассути ин пермеза интиқол дода мешавад. Ғайр аз он, дуюми ин интиқолдиҳандагони ба Мал монанд ABC дар С, рамзгузорӣ шудааст malX, малФ, малГ, ва SMU.1571 ҳамчун интиқолдиҳандаи тахминии мальтоза/малтодекстрин шарҳ дода шудааст. Аммо, то ҷое ки мо медонем, ягон далели таҷрибавӣ барои тасдиқи ин таъинот вуҷуд надорад. Дар рафти тадкикоти дахлдор мо кайд кардем, ки С штаммҳое, ки ҳам пермезаи функсионалии Msm ва ҳам интиқолдиҳандаи ABC ба монанди Мал надоштанд, ҳоло ҳам қодир буданд мальтозаро фермент кунанд ва онро ҳамчун манбаи ягонаи карбон дар муҳити ҳадди ақали қаблан тавсифшуда истифода баранд (22) барои дастгирии афзоиш (расми ​) Расми 1). 1). Аз ин рӯ, маълум аст, ки дар он як интиқолдиҳандаи номаълуми мальтоза мавҷуд аст С ва ин метавонад гузариши асосии мальтоза/малтодекстрин дар ин намуд бошад.

Афзоиши С UA159 (хатҳои сахт), изогенӣ msmK::aphA3 мутант (хатҳои нуқта KCL57), SMU.1571::aphA3 мутант (хати рахнаи KCL48) ва msmK::aphA3 SMU.1571::эри мутант дукарата (хатти тире-нуқта-нуқта-тире) дар муҳити ҳадди ақали дорои 10 мм мальтоза ҳамчун манбаи ягонаи карбон. Маълумоте, ки нишон дода шудааст, воситаҳои ҳадди аққал се таҷрибаи мустақил мебошанд.

Илова ба интиқолдиҳандаҳои ABC ба Msm ва Мал монанд, дар 14 системаи интиқоли фосфоэнолпируват вобаста ба фосфотрансфераза (PTS) мавҷуданд. С (2). Чунин интиқолдиҳандаҳо инчунин дар интиқоли як қатор карбогидратҳо иштирок мекунанд (21). Далелҳои биохимиявӣ мавҷуданд, ки баъзе стрептококкҳои шифоҳӣ PTS-и мальтоза, аз ҷумла штамми OMZ176-ро рамзгузорӣ мекунанд, ки гарчанде ки дар аввал чунин тавсиф шудааст. С, ҳоло ҳамчун дубора тасниф карда шудааст Streptococcus sobrinus (23). Аммо, шахсияти генҳои стрептококк, ки чунин PTS-и мальтозаро рамзгузорӣ мекунанд, маълум нест. Бинобар ин мо пешниход кардем, ки яке аз С Интиқолдиҳандагони PTS интиқолдиҳандаи номаълуми мальтоза мебошанд ва кӯшиш карданд, ки ин фарзияро тафтиш кунанд.

Дар дигар намудҳои бактерияҳо як қатор PTS хоси мальтоза пайдо шудааст. Дар E. coli штаммҳое, ки интиқолдиҳандаи функсионалии Mal ABC надоранд, аз ҳад зиёд ифода кардани malX, ки дар E. coli интиқолдиҳандаи PTS-ро рамзгузорӣ мекунад, қобилияти афзоишро дар мальтоза барқарор мекунад ва нишон медиҳад, ки ин PTS метавонад мальтозаро интиқол диҳад (12). Бо вуҷуди ин, пешниҳод карда шуд, ки MalX мальтозаро тавассути диффузияи осон интиқол медиҳад ва мальтоза субстрати табиии ин интиқолдиҳанда нест (12). Баръакс, маълум аст, ки мальтоза субстрати асосии он мебошад Enterococcus faecalis MalT, азбаски ғайрифаъол кардани гени рамзгузори ин PTS 97° кам шудани [14C]мальтоза ва афзоиши назарраси E. faecalis оид ба мальтоза (9). Ба ҳамин монанд, дар Bacillus subtilis мальтоза аз ҷониби PTS, MalP (17) хоси малтоза гирифта мешавад.

Ҳар як PTS мальтозаи қаблан тавсифшуда ба оилаи глюкоза-глюкозиди PTS тааллуқ дорад (таснифи нақлиёт № 4.A.1.1) (14). Аз ин рӯ, мо ҷузъҳои EII-и аъзоёни ин оиларо муқоиса кардем С бо интиқолдиҳандагони тавсифшудаи мальтозаи PTS ва PTS-и глюкозаи алоқаманд, ки ба зерсохтори якхелаи таснифоти интиқолдиҳанда тааллуқ доранд (расми ​ (расми 2). 2). Аз 14 PTS танҳо 4-тоаш мавҷуд аст С UA159 ба оилаи глюкоза-глюкозидҳо тааллуқ дорад. Инҳо BglP (а β-глюкозидҳои хоси PTS [6]), ScrA (як PTS хоси сахароза [16]), PttB (як PTS тахминии трегалоза хос) ва протеини номуайяншудаи SMU.2047 мебошанд. Танҳо яке аз С сафедаҳо ба системаи тавсифшудаи мальтоза шабоҳати махсус доштанд. Гене, ки ин PTS (SMU.2047)-ро рамзгузорӣ мекунад, аслан номгузорӣ шуда буд ptsG аз ҷониби аннотаторҳои геном. Бо вуҷуди ин, сафедаи рамзгузорӣ танҳо 33 & # x00025 якхела аст B. subtilis PtsG. Назар ба, С PtsG 64 & # x00025 якхела аст E. faecalis MalT, як PTS, ки пас аз он тавсиф карда шуд С геном шарҳ дода шуд (9). Аз ин рӯ, мо пешниҳод менамоем, ки ба ҷои он ки PTS-и мушаххаси глюкоза бошад, С PtsG орфологи аст E. faecalis MalT, ва аз ин рӯ, он бояд ба MalT ё EII mal иваз карда шавад. Тавре ки бо E. faecalis MalT (9), С MalT як протеини мураккабест, ки дорои доменҳои омехташудаи EIIA, EIIB ва EIIC мебошад.

Гарчанде С MalT (PtsG) дорои шахсияти бо E. faecalis MalT, контексти генетикии генҳое, ки ин пермезаро дар ин ду намуд рамз мекунанд, гуногун аст. Мавҷуд набудани дар он махсусан қайд карда мешавад С аз ягон орфологии намоёни E. faecalis malP, ки фосфорилазаи мальтозафосфатиро рамзгузорӣ мекунад. Ҳеҷ далеле вуҷуд надорад, ки ягон генҳои атрофро дар бар мегирад S. mutans malT бо мубодилаи мальтоза алоқаманданд. Аммо, маҳсулоти SMU.2046c ба гидролазаҳои аз металл вобаста монандӣ дорад (COG3568). Аз ин рӯ, мумкин аст, ки ин ген гидролазаи мальтоза-6-фосфатро рамзгузорӣ кунад ва барои мубодилаи мальтоза ба ҳуҷайра тавассути MalT интиқол дода шавад, аммо ин тасдиқи таҷрибавиро талаб мекунад.

Барои тасдик кардани он С MalT (PtsG) як ортологи функсионалии аст E. faecalis MalT, мо муносибати мутагенези мақсаднокро қабул кардем. Қаблан хабар дода шуда буд, ки ғайрифаъол шудани S. mutans malT (ptsG) мубодилаи шакарро тағир надодааст (1). Аммо, мальтоза ва мальтодекстринҳо ба ин таҳқиқот дохил карда нашудаанд. Аз ин рӯ, мо ғайрифаъол кардем малТ, бо истифода аз усулҳои стандартии коркарди генетикӣ (15) ва стратегияи клонсозӣ, ки дар Ҷадвали 'Ҷадвали 'Ҷадвали 'Ҷадвали 1, 1 оварда шудаанд, бо истифода аз праймерҳои дар Ҷадвали 'Ҷадвали 'Ҷадвали 2, 2, пеш аз табдил додан С, тавре ки қаблан тавсиф шудааст (11), бо малТ::Spec r DNA аз pKCL163, тавлиди a малТ мутант, KCL93. Таҳлили транскрипсияи баръакс-PCR (RT-PCR) бо праймерҳои дар ҷадвали 'Ҷадвали 2, 2 овардашуда тасдиқ кард, ки воридкунӣ ба малТ транскрипсияи ягон генҳои ҳамсояро халалдор накардааст, аз ҷумла SMU.2046c (праймерҳои P275 ва P276) ва реА (SMU.2045 праймерҳои P277 ва P278). Як порчаи дохилии малТ тавассути RT-PCR бо истифода аз праймерҳои P273 ва P274 тақвият дода шуд ва андозаи ин маҳсулот бо ворид кардани гени Spec r мувофиқ буд. Ин таҳлили RT-PCR низ нишон дод, ки малТ бо SMU.2046c (праймерҳои P281 ва P282) нусхабардорӣ шудааст, реА (SMU.2045 праймерҳои P238 ва P284), ва гени тахминӣ ҳамчун SMU.2048 шарҳ дода шудааст (праймерҳои P279 ва P280). Ифодаи муштарак бо SMU.2048 интизор набуд, зеро он ба таври дивергентӣ аз малТ. Бо вуҷуди ин, ҳангоми тафтиши муфассали пайдарпаии бо номи SMU.2048 шарҳ додашуда, мо шубҳа дорем, ки ин гени воқеӣ аст, зеро он ҳамагӣ 152 нуклеотид дорад, он кодони ошкори ибтидоӣ надорад ва он ба генҳои маълум шабоҳати ҷиддӣ надорад.

ЉАДВАЛИ 1.

Штаммҳо ва плазмидҳое, ки дар ин таҳқиқот истифода мешаванд

Штамм ё плазмидТавсифиСарчашма ё истинод
Штаммҳо
    UA159С ATCC 700610ATCC
    KCL48С UA159 SMU.1571::aphA3Ин тадқиқот
    KCL57С UA159 msmK::aphA3Ин тадқиқот
    KCL82С UA159 msmK::aphA3 СМУ.1571::Эм р Ин тадқиқот
    KCL93С UA159 malT (ptsG)::Махсус р Ин тадқиқот
    KCL103KCL93 pKCL166Ин тадқиқот
    KCL104KCL93 pVA838Ин тадқиқот
Плазмидҳо
    pCR2.1-TOPOВектори клонкунӣ барои маҳсулоти PCR Km r Amp r Invitrogen Life Technologies
    pCR4-TOPOВектори клонкунӣ барои маҳсулоти PCR Km r Amp r Invitrogen Life Technologies
    pNE1gfppDL278 shuttle вектори бо gfpmut2 ба сайти EcoRI клон карда шудааст4
    pVA838E. coli-Стрептококк намудҳои shuttle вектори Cm r Em r 10
    pALH124pALH123 интиқоли ғайриқутбӣ aphA3 (Км р ) кассетаA. L. Honeyman
    pKCL134pALH124 дорои эри (Em r ), аз pVA838 бо праймерҳои P184 ва P185 пурқувват карда шуда, иваз карда мешаванд aphA3 байни сайтҳои ҲиндIIIИн тадқиқот
    pKCL55pCR4-TOPO дорои SMU.1571 аз UA159, бо истифода аз праймерҳои P84 ва P85 пурқувват карда шудаастИн тадқиқот
    pKCL63pCR4-TOPO дорои msmK аз UA159, бо истифода аз праймерҳои P96 ва P99 тақвият дода мешавадИн тадқиқот
    pKCL90pUC19 дорои msmK аз pKCL63 ҳамчун порчаи 1,5 кб SphI/SacI клон карда шудаастИн тадқиқот
    pKCL96pUC19 дорои SMU.1571 аз pKCL55 ҳамчун порчаи 1,9 кб EcoRI клон карда шудаастИн тадқиқот
    pKCL98pKCL90 бо aphA3 аз pALH124 ба сайти EcoRV клон карда шудааст msmKИн тадқиқот
    pKCL103pKCL96 бо aphA3 аз pALH124 ба сайти HpaI дар SMU.1571 клон карда шудаастИн тадқиқот
    pKCL148pKCL96 бо эри аз pKCL134 ба сайти HpaI дар SMU.1571 клон карда шудаастИн тадқиқот
    pKCL154pCR2.1-TOPO дорои malT (ptsG) (SMU.2047) аз UA159 бо истифода аз праймерҳои P228 ва P229 тақвият дода шудаастИн тадқиқот
    pKCL156pCR2.1-TOPO дорои гени муқовимати спектиномицин аз pNE1gfp, бо истифода аз праймерҳои P232 ва P233 тақвият дода мешавадИн тадқиқот
    pKCL163malT (ptsG)::Spec r, яъне гени муқовимати спектиномицин аз pKCL156, ки дар байни сайтҳои HpaI дар малТ дар pKCL154, нест кардани 165 bpИн тадқиқот
    pKCL161pCR4-TOPO дорои malT (ptsG) (SMU.2047) аз UA159, бо истифода аз праймерҳои P235 ва P236 тақвият дода шудаастИн тадқиқот
    pKCL166pVA838 дорои malT (ptsG) аз pKCL161 ба сайти беназири SalI ворид карда шудаастИн тадқиқот

ЉАДВАЛИ 2.

Примерҳои олигонуклеотид, ки дар ин таҳқиқот истифода мешаванд

Функсияи ибтидоӣ ва номипайдарпай
Клонкунӣ
    P84GCATGCGTACTGATCGCCATTCCAATC
    P85GCTTTGGCAGCTGCTGTT
    P96GCATGCATCAAATTAATTCAACTTAC
    P99GAGCTCTTATCGAATGGCTGCTTCC
    P184AAGCTTAAAAGGAAGGAAATAATAAATGAACAAAAATAATAAAATA
    P185AAGCTTCTATTATTTCCTCCCGTTAAATAAG
    P228CAATCAAGAAAAGGAGCGGAATC
    P229GAAAAAGATGTTTGCTGGGAGGT
    P232CCCGGGAAAAGAGGAAGGAAATAATAAGTGAGGAGGATATATTTGAA
    P233CCCGGGCTATTATAATTTTTTTTAATCTGT
    P235GTCGACTTAAAGTTCTACTTTGGCGA
    P236GTCGACGTTTGCGGAGCTTTCTTA
Таҳлили RT-PCR
    P273GTATGTGGATTGCTTCTTCACAA
    P274AACCTTGAACAACAGCGTAAAC
    P275ATGATGTTATTTGCGTTCAAGAGG
    P276GCTTGATACCCTTCATTTTCATAAG
    P277TGGTGTCACAAAGCTAGGGA
    P278GCATGGCATAAACATCACTTTG
    P279GGTAATGCAGGATTTGATTTTC
    P280GCAGGCATAACAGCAATAACA
    P281GATGGTTTCGCTGTTGAGC
    P282GCAGGTTCTGAATGCAAAAG
    P283CTTTTAATGGGGGATTTTAACAACC
    P284CTAAAATTCCTGCAACCTGAATAG

Қобилиятҳои намуди ваҳшӣ С UA159 ва изогенӣ малТ (ptsG) мутант барои истифодаи мальтоза ва мальтодекстринҳо ҳамчун манбаи ягонаи карбон тавассути мушоҳидаи афзоиш дар муҳити нимтайёр муайян карда шуданд (расми ​ (расми 3). 3). Ин миёнарави нимтайёр дар нашрияи қаблӣ тавсиф шудааст (22). Афзоиш тавассути инкубатсия кардани пластинаҳои микротитрии 96-чоҳ, ки қаблан дар шароити анаэробӣ мувозинат карда ва мӯҳр карда шуда буданд, муайян карда шуд (80 º0025 N.2, 10% H2, 10 & # x00025 CO2), дар 37ºC дар як хонандаи пластинкаи микротитр (Labsystems iEMS reader MF Thermo Life Sciences) ва сабт кардани зичии оптикӣ (620 нм) дар фосилаи 15 дақиқа пас аз ларзиш.

Афзоиши С UA159 (хатҳои сахт), изогенӣ малТ мутант (хатҳои нуқта KCL93), мукаммалшуда малТ мутант (хатҳои рахнаи KCL103) ва пурранашуда малТ назорати плазми муттанти (KCL104 хати-нуқта-нуқта-тире) дар муҳити ҳадди ақал дорои 10 мм мальтоза (A), 10 мм мальтотетраоза (B), 10 мМ мальттриоза (C) ё 20 мм глюкоза (D) ҳамчун карбон ягона сарчашма. Маълумоте, ки нишон дода шудааст, воситаҳои ҳадди аққал се таҷрибаи мустақил мебошанд.

Гарчанде ки малТ мутант тавонист дар мальтоза ҳамчун манбаи ягонаи карбон афзоиш ёбад, он танҳо бо суръати хеле кам дар муқоиса бо афзоиши С UA159 (расми ​ (расми 3А). 3А). Инчунин кобилияти истифодаи мальтотетраоз ва малтотриоза кам шуд (расми 3В ва С). Баръакс, байни навъи ваҳшӣ ва ваҳшӣ фарқият вуҷуд надошт малТ мутант, вақте ки глюкоза (расми ​ (расми 3D) 3D) ё изомалтоза (маълумот нишон дода нашудааст) манбаи ягонаи карбон буд. Таҳлили афзоиши мукаммалшуда малТ мутант, KCL103, тасдиқ кард, ки фенотипи мушоҳидашуда дар натиҷаи мутатсияи ин ген аст, на ягон мутатсияи дуввум (расми ​ (расми 3). 3). Ин маълумотҳо фарзияро дастгирӣ мекунанд, ки MalT интиқолдиҳандаи асосии мальтоза дар он аст С ва на, тавре ки дар аввал тахмин карда шуда буд, PTS-и хоси глюкоза нест. Ҳамин тариқ, С MalT як орфологии аст E. faecalis МалТ.

Камшавии камшавии афзоиш дар мальтотетраоз ва малтотриоза (расми ​ (расми 3) 3) нишон медиҳад, ки ин мальтодекстринҳо метавонанд субстратҳои MalT бошанд, аммо интиқолдиҳандагони алтернативии ин карбогидратҳо бояд дар С. Қаблан хабар дода шуда буд, ки интиқолдиҳандаи асосии изомалтоза дар С интиқолдиҳандаи Msm мебошад (13, 20). Эҳтимол аст, ки мальтотетраоз ё мальттриоза инчунин тавассути ин ё интиқолдиҳандаи ба Мал монанд ба ABC интиқол дода шавад, аммо барои тасдиқи ин таҳқиқоти иловагӣ лозим аст.

Маълумоти афзоиши пешниҳодшуда далели қавии он аст, ки MalT дар қабули мальтоза иштирок мекунад. Бо вуҷуди ин, барои тасдиқи ин, мо як қатор таҳлилҳои қабули радиоактивиро бо истифода аз [U-14 C]малтоз (Amersham GE Healthcare) анҷом додем. С штаммҳо дар муҳити нимтайёр (қаблан тавсиф шуда буд [22]) бо 20 мм глюкоза, 10 мм мальтоза ё 5 мм глюкоза плюс 10 мм мальтоза ҳамчун манбаи ягонаи карбон парвариш карда шуданд. Ба таври экспоненсиалӣ афзоиш меёбад С ҳуҷайраҳо тавассути центрифугакунӣ ҷамъоварӣ карда шуданд, вақте ки зичии оптикӣ (620 нм) тақрибан 0,5 буд ва гирифтани [U-14 C] мальтоза бо усули филтратсияи фаврӣ, ки қаблан тавсиф шуда буд, бо консентратсияи ниҳоии 25 º03bcM ва 0,125 º санҷида шуд. x003bcCi [U- 14 C] мальтоза (22). Дар С штаммҳое, ки фаъол набуданд малТ (KCL93 ва KCL104) натавонистанд [U- 14 C] малтозаро ҷамъ кунанд, дар ҳоле ки штамм навъи ваҳшӣ (UA159) ва мутант пуррашуда (KCL103) ин корро бо суръати тез анҷом доданд (расми ​ (расми 4)) 4). Ин тасдиқ мекунад, ки MalT интиқолдиҳандаи асосии мальтоза мебошад С.

Гирифтани [U-14 C] мальтоза аз ҷониби С UA159 (A) (рамзҳои пур), KCL93, изогенӣ малТ мутант (A) (рамзҳои кушода), KCL103, мукаммалшуда малТ мутант (B) (рамзҳои пӯшида) ва KCL104, пурранашуда малТ назорати плазми мутант (B) (рамзҳои кушода), ки дар муҳити ҳадди ақали дорои глюкозаи 20 мм (мураббаъҳо), 10 мм мальтоза (секунҷаҳо) парвариш карда мешаванд (танҳо UA159 ва KCL103, зеро малТ мутант наметавонад дар мальтоза ҳамчун манбаи ягонаи карбон) ё 5 мм глюкоза плюс 10 мм мальтоза (давраҳо) афзоиш ёбад. Маълумоте, ки нишон дода шудааст, воситаҳои ҳадди аққал се таҷрибаи мустақил мебошанд.

Суръати азхудкунии [U- 14 C] мальтоза тавассути дохил кардани мальтоза ба муҳити афзоиш, на глюкоза, каме афзоиш ёфт (расми ​ (расми 4), 4), ки нишон медиҳад, ки мавҷудияти ин субстрат ифодаро зиёд мекунад. аз малТ. Бо вуҷуди ин, суръати баланди азхудкунии [U-14 C] мальтоза барои С ки дар глюкоза ҳамчун манбаи ягонаи карбон парвариш карда мешавад (расми ​ (расми 4) 4) нишон медиҳад, ки малТ дар ин шароит ифода меёбад ва он ба репрессияи назарраси катаболит дучор намешавад.

To obtain an indication of the range of solutes transported by MalT, [U- 14 C]maltose uptake was carried out in the presence of 1 mM (40-fold excess) competing solutes (Fig. ​ (Fig.5). 5 ). None of the substrates tested inhibited uptake to the same extent as an excess of unlabeled maltose, which reduced uptake to only 5% of the control rate. Therefore, it is likely that MalT has greatest affinity for maltose. However, maltotriose, mannose, galactose, and fructose each inhibit [U- 14 C]maltose uptake by 60 to 72%, and maltotetraose, glucose, sucrose, and raffinose inhibit it by 28 to 42%. It is thus possible that these are substrates of MalT, with the latter group being lower-affinity substrates, although it is also possible that some are not actual substrates for this transporter but merely inhibit uptake of maltose. Nevertheless, it is apparent that MalT is at least not the sole transporter in С for some of these substrates. As discussed above, our growth data (Fig. ​ (Fig.3) 3 ) indicate there are other transporters for maltotriose and maltotetraose. Furthermore, Abranches et al. (1) report that a malT mutant, which they refer to as a ptsG mutant, had no altered glucose, fructose, and mannose PTS activity compared to the wild-type strain. It is therefore unlikely that MalT is the dominant transporter of these carbohydrates.

Inhibition of [U- 14 C]maltose uptake by competing solutes. The rate of [U- 14 C]maltose uptake by С UA159 grown in minimal medium containing 20 mM glucose was determined over the initial minute of uptake. Competing solutes were added to a final concentration of 1 mM, 5 s before the addition of 25 μM (0.06 㯌i) [U- 14 C]maltose.

Orthologues of С MalT are apparent, as a result of BLAST (3) searches, in the genomes of other Стрептококк species, including Streptococcus pneumoniae TIGR4 and R6, Streptococcus pyogenes MGAS5005, Streptococcus agalactiae 2603V/R, and Streptococcus suis 89/1591. Therefore, MalT orthologues may also play an important role in maltose and maltodextrin uptake in these important pathogens. It has been proposed that maltodextrin transport is a key component for the initial colonization of the oropharynx by S. pyogenes (18). In contrast to our observations with С, mutation of the gene encoding a single ABC transporter component in S. pyogenes, malE (which is similar to the genes encoding the solute binding proteins of С Msm and Mal-like ABC transporters), significantly impaired growth on maltose as a sole carbon source (18). We speculate that the MalT orthologue enables the residual growth on maltose in this malE mutant. However, it is clear that MalT alone cannot support optimum growth on maltose for S. pyogenes. Therefore, there are apparent differences in the relative contribution of MalT to maltose transport in S. pyogenes compared to that in С. Further research is required to determine whether the MalT orthologue in S. pyogenes contributes to colonization.


Streptococcus mutans bacteria, illustration - stock illustration

Your Easy-access (EZA) account allows those in your organization to download content for the following uses:

  • Tests
  • Намунаҳо
  • Composites
  • Тарҳҳо
  • Rough cuts
  • Preliminary edits

It overrides the standard online composite license for still images and video on the Getty Images website. The EZA account is not a license. In order to finalize your project with the material you downloaded from your EZA account, you need to secure a license. Without a license, no further use can be made, such as:

  • focus group presentations
  • external presentations
  • final materials distributed inside your organization
  • any materials distributed outside your organization
  • any materials distributed to the public (such as advertising, marketing)

Because collections are continually updated, Getty Images cannot guarantee that any particular item will be available until time of licensing. Please carefully review any restrictions accompanying the Licensed Material on the Getty Images website, and contact your Getty Images representative if you have a question about them. Your EZA account will remain in place for a year. Your Getty Images representative will discuss a renewal with you.

By clicking the Download button, you accept the responsibility for using unreleased content (including obtaining any clearances required for your use) and agree to abide by any restrictions.


Biofilm formation as a complex process of protein�terium interaction

The most common oral cavity infectious disease in which an important causative role is played by biofilms formed by microorganisms on the teeth and gums surface is dental caries. One of the main etiological factors of the above-mentioned disease is С [23�].

Caries is the most common childhood illness. It is estimated to occur five times more often than the second most common childhood illness, asthma [26]. The Decayed, Missing and Filled Teeth (DMFT) index rate was observed for Bolivia, Guatemala, Bosnia and Herzegovina, and Philippines. Directly behind them in contrast, the lowest DMFT index rate was observed for Russia, Europe’s Eastern Bloc including Poland, and most South American countries [27, 28].

Comparing the DMFT index rate for European countries, one can observe that the epidemiological situation in Poland is not ideal. In 2012, the DMFT index rate for 12-year-olds was estimated at 4.4, whereas the lowest observed in Holland was estimated at 0.9 and the highest in Latvia was estimated at 7.7. In terms of 6-year-olds, the situation deteriorates because, among the countries under investigation, the highest DMFT index rate equal to 5.1 was recorded in Poland. It is estimated that, in Poland, dental caries is observed in 35� % of children aged 2𠄳 years and in 50� % of children aged 3𠄴 years [27, 29]. According to alarming reports from the World Health Organization (WHO) and the National Institute of Public Health (PZH), dental caries is observed in almost 100 % of children aged 6𠄷 years. Caries in permanent teeth starts just after the dentition of the first molar teeth and has been reported in approximately 90 % of Polish 12-year-old children [30, 31].

In the view of the above data, it is extremely important to understand more fully the mechanisms of cariogenic strain activity on the basis of the biofilm formed by them, which may be applied in the prevention and early diagnostics of dental caries in children.

Biofilms present in the oral cavity are three-dimensional structures, consisting of bacterial strains anchored to solid surfaces such as tooth enamel, tooth roots or dental implants. They are embedded in an exopolysaccharide matrix [32]. Over 700 different bacterial species incorporating into biofilms have been identified so far [33, 34]. The structure and composition of the exopolysaccharide matrix is determined by the conditions existing in the oral cavity and change over time. The extracellular polysaccharides (EPS) also affect the physical and biochemical properties of the biofilm [6, 35].

The primary sources of EPS are glucosyltransferase (GTF) and fructosyltransferase (Ftf), products of interaction with sucrose and starch hydrolysates. Exopolymers contained in the polysaccharide matrix form its stability and provide possibilities of binding bacterial cells [6, 35, 36]. Research on the composition of the polysaccharide matrix revealed the presence of components as shown in Fig.  1 .


The Lancefield Classification System

Bacteria are amazing organisms with many different features. Scientists have tried to bring order to their classification. The Lancefield system for classifying a particular category of bacteria was created by a microbiologist named Rebecca Lancefield (1891 to 1985). The bacteria belonged to the family Streptococcaceae and were Gram-positive and catalase-negative.

The results of the Gram staining test depend on the structure of the outer covering of a bacterial cell. Gram-positive cells and Gram-negative ones display a different color when they are tested with the stain. The term "Gram" is derived from the name of Hans Christian Gram, who created the staining procedure. Catalase is an enzyme that converts hydrogen peroxide to water and oxygen. It&aposs found in many organisms that use oxygen. Streptococci lack the enzyme, however.

Lancefield divided the bacteria into alphabetical groups going from Group A to Group S. Her system is not often used in its original form today, but the Group A and B categories are still used. As in the case of the name of the bacterium’s genus, the terms “Group A” and “Group B” are sometimes capitalized but often aren’t.

The information in this article is given for general interest. Someone who experiences any of the symptoms that are mentioned below should visit a doctor for a diagnosis and treatment. People who may be at risk for a streptococcus infection should also consult their doctor.


  • Dentin is produced continuously throughout life by odontoblasts.
  • Caries can be classified by location, etiology, rate of progression, and affected hard tissues.
  • Enamel is a highly mineralized acellular tissue. Enamel rods, which are the basic unit of the enamel structure, run perpendicularly from the surface of the tooth to the dentin.
  • There are four main criteria required for caries formation: a tooth surface (enamel or dentin), caries-causing bacteria, fermentable carbohydrates (such as sucrose), and time.
  • Dental caries can occur on any surface of a tooth that is exposed to the oral cavity, but not the structures that are retained within the bone.
  • The two bacteria most commonly responsible for dental cavities are Streptococcus mutans and Lactobacillus.
  • The use of dental sealants is a means of prevention.
  • Professional hygiene care consists of regular dental examinations and cleanings.
  • An extraction can also serve as treatment for dental caries.
  • In general, early treatment is less painful and less expensive than treatment of extensive decay.
  • Recurrent caries, also described as secondary, are caries that appears at a location with a previous history of caries.
  • Dentin is produced continuously throughout life by odontoblasts.
  • Personal hygiene care consists of proper brushing and flossing daily. The purpose of oral hygiene is to minimize any etiologic agents of disease in the mouth.
  • Primary diagnosis involves inspection of all visible tooth surfaces using a good light source, dental mirror and explorer. Dental radiographs (X-rays) may show dental caries before it is otherwise visible, in particular caries between the teeth.
  • Caries can be classified by location, etiology, rate of progression, and affected hard tissues.
  • In dentin from the deepest layer to the enamel, the distinct areas affected by caries are the advancing front, the zone of bacterial penetration, and the zone of destruction.
  • Intrauterine and neonatal lead exposure promote tooth decay. Other divalent cations, such as cadmium, mimic the calcium ion and therefore exposure may promote tooth decay.
  • From the deepest layer of the enamel to the enamel surface, the identified areas are the: translucent zone, dark zones, body of the lesion, and surface zone.
  • Enamel is a highly mineralized acellular tissue. Enamel rods, which are the basic unit of the enamel structure, run perpendicularly from the surface of the tooth to the dentin.
  • Some brands of smokeless tobacco contain high sugar content, increasing susceptibility to caries. Tobacco use is a significant risk factor for periodontal disease, which can cause the gingiva to recede.
  • Reduced saliva is associated with increased caries.
  • There are four main criteria required for caries formation: a tooth surface (enamel or dentin) caries-causing bacteria fermentable carbohydrates (such as sucrose) and time.
  • If demineralization exceeds saliva and other remineralization factors such as from calcium and fluoridated toothpastes, these tissues progressively break down, producing dental caries (cavities, holes in the teeth).
  • The presentation of caries is highly variable.
  • Bacteria collect around the teeth and gums in a sticky, creamy-coloured mass called plaque, which serves as a biofilm.
  • Dental caries can occur on any surface of a tooth that is exposed to the oral cavity, but not the structures that are retained within the bone.
  • The mineral content of teeth is sensitive to increases in acidity from the production of lactic acid.
  • Radiographs are used for less visible areas of teeth and to judge the extent of destruction.
  • Depending on the extent of tooth destruction, various treatments can be used to restore teeth to proper form, function, and aesthetics, but there is no known method to regenerate large amounts of tooth structure. Instead, dental health organizations advocate preventive and prophylactic measures, such as regular oral hygiene and dietary modifications, to avoid dental caries.
  • Tooth decay disease is caused by specific types of bacteria that produce acid in the presence of fermentable carbohydrates such as sucrose, fructose, and glucose.
  • Before the cavity forms, the process is reversible, but once a cavity forms, the lost tooth structure cannot be regenerated.
  • The two bacteria most commonly responsible for dental cavities are Streptococcus mutans and Lactobacillus.
  • cementum: A bony substance that covers the root of a tooth cement.
  • сирдор: The hard covering on the exposed part of a tooth.
  • dentin: The hard, dense calcareous material that makes up the bulk of a tooth

Dental caries, also known as tooth decay or a cavity, is an infection, usually bacterial in origin, that causes demineralization of the hard tissues (enamel, dentin, and cementum ) and destruction of the organic matter of the tooth, usually by production of acid by hydrolysis of the food debris accumulated on the tooth surface. If demineralization exceeds saliva and other remineralization factors such as from calcium and fluoridated toothpastes, these tissues progressively break down, producing dental caries (cavities, holes in the teeth). The two bacteria most commonly responsible for dental cavities are Streptococcus mutans and Lactobacillus. If left untreated, the disease can lead to pain, tooth loss, and infection. Today, caries remain one of the most common diseases throughout the world.

Caries can be classified by location, etiology, rate of progression, and affected hard tissues. These forms of classification can be used to characterize a particular case of tooth decay in order to more accurately represent the condition to others and also indicate the severity of tooth destruction.

Tooth decay disease is caused by specific types of bacteria that produce acid in the presence of fermentable carbohydrates such as sucrose, fructose, and glucose. The mineral content of teeth is sensitive to increases in acidity from the production of lactic acid. To be specific, a tooth (which is primarily mineral in content) is in a constant state of back-and-forth demineralization and remineralization between the tooth and surrounding saliva. For people with little saliva, especially due to radiation therapies that may destroy the salivary glands, there also exists remineralization gel. These patients are particularly susceptible to dental caries. When the pH at the surface of the tooth drops below 5.5, demineralization proceeds faster than remineralization (meaning that there is a net loss of mineral structure on the tooth&rsquos surface). Most foods are in this acidic range and without remineralization result in the ensuing decay.

As the enamel and dentin are destroyed, the cavity becomes more noticeable. The affected areas of the tooth change color and become soft to the touch. Once the decay passes through enamel, the dentinal tubules, which have passages to the nerve of the tooth, become exposed, causing a toothache. The pain may worsen with exposure to heat, cold, or sweet foods and drinks. Dental caries can also cause bad breath and foul tastes. In highly progressed cases, infection can spread from the tooth to the surrounding soft tissues. Complications such as cavernous sinus thrombosis and Ludwig&rsquos angina can be life-threatening.

Расм: Dental caries: (A) A small spot of decay visible on the surface of a tooth. (B) The radiograph reveals an extensive region of demineralization within the dentin (arrows). (C) A hole is discovered on the side of the tooth at the beginning of decay removal. (D) All decay removed.

There are four main criteria required for caries formation: a tooth surface (enamel or dentin) caries-causing bacteria, fermentable carbohydrates (such as sucrose), and time. The caries process does not have an inevitable outcome, and different individuals will be susceptible to different degrees depending on the shape of their teeth, oral hygiene habits, and the buffering capacity of their saliva. Dental caries can occur on any surface of a tooth that is exposed to the oral cavity, but not the structures that are retained within the bone. All caries occur from acid demineralization that exceeds saliva and fluoride remineralization, and almost all acid demineralization occurs where food (containing carbohydrate like sugar) is left on teeth. Though most trapped food is left between teeth, over 80% of cavities occur inside pits and fissures on chewing surfaces where brushing, fluoride, and saliva cannot reach to remineralize the tooth as they do on easy-to-reach surfaces that develop few cavities.

In most people, disorders or diseases affecting teeth are not the primary cause of dental caries. Ninety-six percent of tooth enamel is composed of minerals. These minerals, especially hydroxyapatite, will become soluble when exposed to acidic environments. Enamel begins to demineralize at a pH of 5.5. Dentin and cementum are more susceptible to caries than enamel because they have lower mineral content. Thus, when root surfaces of teeth are exposed from gingival recession or periodontal disease, caries can develop more readily. Even in a healthy oral environment, however, the tooth is susceptible to dental caries.

Bacteria in a person&rsquos mouth convert glucose, fructose, and most commonly sucrose (table sugar) into acids such as lactic acid through a glycolytic process called fermentation. If left in contact with the tooth, these acids may cause demineralization, which is the dissolution of its mineral content. The process is dynamic, however, as remineralization can also occur if the acid is neutralized by saliva or mouthwash.

At times, pit and fissure caries may be difficult to detect. Bacteria can penetrate the enamel to reach dentin, but then the outer surface may remineralize, especially if fluoride is present. These caries, sometimes referred to as &ldquohidden caries&rdquo, will still be visible on x-ray radiographs, but visual examination of the tooth would show the enamel intact or minimally perforated.

Расм: Pit and fissure caries.: The progression of pit and fissure caries resembles two triangles with their bases meeting along the junction of enamel and dentin.


Microbiologists Discover How Cavity-Causing Microbes Invade Heart

Scientists have discovered the tool that bacteria normally found in our mouths use to invade heart tissue, causing a dangerous and sometimes lethal infection of the heart known as endocarditis. The work raises the possibility of creating a screening tool – perhaps a swab of the cheek, or a spit test – to gauge a dental patient’s vulnerability to the condition.

The identification of the protein that allows Streptococcus mutans to gain a foothold in heart tissue is reported in the June issue of Инфекция ва иммунитет by microbiologists at the University of Rochester Medical Center.

С is a bacterium best known for causing cavities. The bacteria reside in dental plaque – an architecturally sophisticated goo composed of an elaborate molecular matrix created by С that allows the bacteria to inhabit and thrive in our oral cavity. There, they churn out acid that erodes our teeth.

Одатан, С confines its mischief to the mouth, but sometimes, particularly after a dental procedure or even after a vigorous bout of flossing, the bacteria enter the bloodstream. There, the immune system usually destroys them, but occasionally – within just a few seconds – they travel to the heart and colonize its tissue, especially heart valves. The bacteria can cause endocarditis – inflammation of heart valves – which can be deadly. Infection by С is a leading cause of the condition.

“When I first learned that С sometimes can live in the heart, I asked myself: Why in the world are these bacteria, which normally live in the mouth, in the heart? I was intrigued. And I began investigating how they get there and survive there,” said Jacqueline Abranches, Ph.D. , a microbiologist and the corresponding author of the study.

Abranches and her team at the University’s Center for Oral Biology discovered that a collagen-binding protein known as CNM gives С its ability to invade heart tissue. In laboratory experiments, scientists found that strains with CNM are able to invade heart cells, and strains without CNM are not.

When the team knocked out the gene for CNM in strains where it’s normally present, the bacteria were unable to invade heart tissue. Without CNM, the bacteria simply couldn’t gain a foothold their ability to adhere was about one-tenth of what it was with CNM.

The team also studied the response of wax worms to the various strains of С . They found that strains without CNM were rarely lethal to the worms, while strains with the protein were lethal 90 percent of the time. Then, when Abranches’ team knocked out CNM in those strains, they were no longer lethal – those worms thrived.

The work may someday enable doctors to prevent С from invading heart tissue. Even sooner, though, since some strains of С have CNM and others do not, the research may enable doctors to gauge a patient’s vulnerability to a heart infection caused by the bacteria.

Abranches has identified five specific strains of С that carry the CNM protein, out of more than three dozen strains examined. CNM is not found in the most common type of С found in people, type C, but is present in rarer types of С, including types E and F.

“It may be that CNM can serve as a biomarker of the most virulent strains of С,” said Abranches, a research assistant professor in the Department of Microbiology and Immunology . “When patients with cardiac problems go to the dentist, perhaps those patients will be screened to see if they carry the protein. If they do, the dentist might treat them more aggressively with preventive antibiotics, for example.”

Until more research is done and a screening or preventive tool is in place, Abranches says the usual advice for good oral health still stands for everyone.

“No matter what types of bacteria a person has in his or her mouth, they should do the same things to maintain good oral health. They should brush and floss their teeth regularly – the smaller the number of С in your mouth, the healthier you’ll be. Use a fluoride rinse before you go to bed at night. And eat a healthy diet, keeping sugar to a minimum,” added Abranches.

Abranches presented the work at a recent conference on the “oral microbiome” hosted by the University’s Center for Oral Biology. The center is part of the Medical Center’s Eastman Institute for Oral Health , a world leader in research and post-doctoral education in general and pediatric dentistry, orthodontics, periodontics, prosthodontics, and oral surgery.


Staphylococcus vs Streptococcus

The main difference between them is in how they look. The Staphylococcus has multiple axes cellular division, which results in its grape-like shape. On the other hand, Streptococcus forms around a single axis, resulting in its chain-like shape. Also, while there are over 30 species of Staphylococci and over 50 species of Streptococci, only the latter is also divided into three separate groups, depending on the substances used to trace them.

Although doctors need to test to check the presence of either a staph or a strep infection, there are specific places where either one is more prone to be found. A staph infection is more likely to affect skin wounds, whereas a strep infection is more likely to affect the ear, nose, and throat areas.


In a current study conducted by a group of biologists from University of North Carolina and Washington University found that S. mutans ftf expressionwas affected by both the specific carbohydrate consumed and the age of the host animal. Дар fructosyltransferase gene (ftf) of С is a gene that directly associated with infection in the mouth (9). Дар ftf gene аз С encodes the product fructosyltransferase, a enzyme that catalyzes the cleavage of sucrose, with subsequent polymerization of the fructose moieties into fructan, allowing it to remain in the dental plaque after its production (9). First, they fed animals with different types of carbohydraes: fructose, glucose and sucrose. Then the bacteria activity was observed. As a result, there was the most bacterial activity found on sucrose, and activities on glucose and fructose were similar, which were only 1/3 of bacteria on sucrose (9). Second, animal age was examined as a potential factor of bacteria gene expression. In the result, young animals had been demonstrated to be more susceptible to the formation of dental caries than older animals. This study demonstrated animal age-dependent expression of an С virulence-associated gene whose product played an important role in the causation of dental caries (9).

Recently, researchers studied the role of WapA gene дар С in cell surface structures, related functions, biofilm formation. Biofilm formation is one of the well-recognized virulence factors of С, which involves a sucrose independent initial attachment, cell–cell aggregation, a sucrose-dependent stabilization, and eventual biofilm muturarion (11). In order to study the role of WapA in cell surface structures and related functions, they constructed an isogenic mutant of WapA by insertional inactivation, then compared with wild type WapA gene(11). First, they labeled the wild type strain and mutant, and analyzed the architecture of the biofilm in order to see if the morphological change would affect the biofilm architecture. The result showed that the wild type cells fromed a biofilm with large but sparsely distributed microcolonies and large areas occupied by unstructured or single-cell chains. However, the mutant formed a thin biofilm and attached to the surface mostly as unstructured cell layers. Second, they tried to find the effect of WapA mutation on cell surface stickiness of С. As they immobilized the two cells, they applied force to cell walls to observe the rupture event due to breakage of adhesive bond of each cell. The result showed that wild type cell was stickier than the mutant. Lastly, they tested both wild type and mutant to see an effect of sucrose on gene expression. They measured the gene expression by PCR in absence and presence of sucrose. The result showed that both WapA wildtype and mutant gene expression were repressed by sucrose. The overall results suggested that the WapA protein plays an important structural role on the cell surface, which ultimately affects sucrose-independent cell–cell aggregation and biofilm architecture (11).

A recent study from the University of Heidelberg conducting by Dr. Geiss suggested that titanium, gold, natural enamel and amalgam alloy were superior to composite materials in reducing the adherence of Streptococcus mutans to dental restorations. In the in vitro study, 73 restorative material specimens were coated with cultured С and then examined with a scanning electron microscope for bacterial adherence (12). Dr. Geiss reported that in the absence of saliva, samples of titanium, gold, natural enamel and amalgam alloy had significantly less С adherence than Herculite XRV, a composite material manufactured by Kerr Dental (12). However, in the presence of saliva, bacterial adherence of С was reduced on the titanium and amalgam samples but increased in most of the other tested materials (12). This study also found that the least С adhered to specimens of titanium, a reactive metal that forms a passivating oxide layer. This findings were very significant in dentistry because Titanium and titanium alloys were commonly used in dental implants and prostheses, crown fabrications, bridge frameworks, and denture frameworks (12).


Видеоро тамошо кунед: Ганчина духтари точик Шармандаги Духтари точик бубинед Чи мега (Ноябр 2022).